AlfalfaGEDB | Msa1166090

M. sativa cultivar zhongmu-4 / Msa1166090

KEGG: K06632
GO: GO:0000075 GO:0000076 GO:0003674 GO:0003824 GO:0004672 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0007049 GO:0007050 GO:0008150 GO:0008152 GO:0009987 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0019538 GO:0022402 GO:0031570 GO:0036211 GO:0043170 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0045786 GO:0048519 GO:0048523 GO:0050789 GO:0050794 GO:0051726 GO:0065007 GO:0071704 GO:0140096 GO:1901564
PFAM: PF00069.28

Nr:

Query id	Subject id	identity %	alignment length	mis matches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa1166090	XP_003625897.1	97.959	490	7	1	1	487	1	490	0.0	999

Swissprot:

Query id	Subject id	identity %	alignment length	mis matches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa1166090	sp\|Q8L4H0\|WEE1_ARATH	59.138	487	187	6	2	480	15	497	0.0	589

Trembl:

Query id	Subject id	identity %	alignment length	mis matches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa1166090	G7KRU4	97.959	490	7	1	1	487	1	490	0.0	999

TFs/TRs:

Gene ID	Type	Classification

Protein Kinases:

Gene ID	Type	Classification

Network:

Co-expression Network

Gene1	Gene2	correlation coefficient	p_value	FDR
Msa0001830	Msa1166090	-0.824014	1.015497e-53	-8.615850e-47
Msa0004840	Msa1166090	-0.812279	4.591357e-51	-8.615850e-47
Msa0007440	Msa1166090	-0.860286	2.296362e-63	-8.615850e-47
Msa0007470	Msa1166090	-0.809910	1.497701e-50	-8.615850e-47
Msa0010490	Msa1166090	-0.866728	2.306480e-65	-8.615850e-47
Msa0010500	Msa1166090	-0.856948	2.277491e-62	-8.615850e-47
Msa0015090	Msa1166090	-0.825788	3.872091e-54	-8.615850e-47
Msa0016510	Msa1166090	-0.812414	4.291087e-51	-8.615850e-47
Msa0017320	Msa1166090	-0.812429	4.258038e-51	-8.615850e-47
Msa0018070	Msa1166090	-0.813605	2.351531e-51	-8.615850e-47
Msa0020390	Msa1166090	-0.859197	4.886376e-63	-8.615850e-47
Msa0020410	Msa1166090	-0.831020	2.114899e-55	-8.615850e-47
Msa0023480	Msa1166090	-0.803849	2.864115e-49	-8.615850e-47
Msa0028660	Msa1166090	-0.804885	1.742847e-49	-8.615850e-47
Msa0030300	Msa1166090	-0.804962	1.679381e-49	-8.615850e-47
Msa0032470	Msa1166090	-0.874829	4.973630e-68	-8.615850e-47
Msa0032880	Msa1166090	-0.805062	1.599944e-49	-8.615850e-47
Msa0033110	Msa1166090	-0.800093	1.694337e-48	-8.615850e-47
Msa0036540	Msa1166090	-0.811005	8.692734e-51	-8.615850e-47
Msa0037540	Msa1166090	0.833879	4.138499e-56	-8.615850e-47
Msa0037590	Msa1166090	0.829767	4.281989e-55	-8.615850e-47
Msa0037840	Msa1166090	-0.810569	1.080186e-50	-8.615850e-47
Msa0037880	Msa1166090	-0.825750	3.953874e-54	-8.615850e-47
Msa0038870	Msa1166090	-0.859820	3.174618e-63	-8.615850e-47
Msa0042550	Msa1166090	-0.800486	1.409302e-48	-8.615850e-47
Msa0043980	Msa1166090	-0.838942	2.130754e-57	-8.615850e-47
Msa0044000	Msa1166090	-0.813977	1.948012e-51	-8.615850e-47
Msa0044330	Msa1166090	-0.804593	2.005483e-49	-8.615850e-47
Msa0049750	Msa1166090	-0.816996	4.146070e-52	-8.615850e-47
Msa0051450	Msa1166090	-0.808621	2.830135e-50	-8.615850e-47
Msa0051860	Msa1166090	-0.811319	7.428488e-51	-8.615850e-47
Msa0052400	Msa1166090	-0.800798	1.216928e-48	-8.615850e-47
Msa0052860	Msa1166090	-0.804043	2.610970e-49	-8.615850e-47
Msa0053010	Msa1166090	-0.804715	1.891135e-49	-8.615850e-47
Msa0054750	Msa1166090	-0.810910	9.111990e-51	-8.615850e-47
Msa0056030	Msa1166090	-0.822121	2.806678e-53	-8.615850e-47
Msa0059950	Msa1166090	-0.832309	1.017224e-55	-8.615850e-47
Msa0061500	Msa1166090	-0.803500	3.385103e-49	-8.615850e-47
Msa0062490	Msa1166090	-0.828268	9.880345e-55	-8.615850e-47
Msa0064300	Msa1166090	-0.818486	1.911842e-52	-8.615850e-47
Msa0065650	Msa1166090	-0.820018	8.562601e-53	-8.615850e-47
Msa0068740	Msa1166090	0.820539	6.503502e-53	-8.615850e-47
Msa0071250	Msa1166090	-0.867592	1.221579e-65	-8.615850e-47
Msa0076320	Msa1166090	-0.821672	3.565269e-53	-8.615850e-47
Msa0079070	Msa1166090	-0.813736	2.200489e-51	-8.615850e-47
Msa0079130	Msa1166090	-0.800965	1.124881e-48	-8.615850e-47
Msa0082680	Msa1166090	0.812098	5.029935e-51	-8.615850e-47
Msa0083280	Msa1166090	-0.807682	4.485962e-50	-8.615850e-47
Msa0086420	Msa1166090	-0.864432	1.221147e-64	-8.615850e-47
Msa0089820	Msa1166090	-0.832757	7.876470e-56	-8.615850e-47
Msa0090550	Msa1166090	-0.872795	2.416730e-67	-8.615850e-47
Msa0090570	Msa1166090	-0.800556	1.363466e-48	-8.615850e-47
Msa0095360	Msa1166090	-0.873600	1.297189e-67	-8.615850e-47
Msa0095770	Msa1166090	-0.867552	1.258448e-65	-8.615850e-47
Msa0096030	Msa1166090	-0.815639	8.337635e-52	-8.615850e-47
Msa0096700	Msa1166090	-0.801814	7.537721e-49	-8.615850e-47
Msa0096980	Msa1166090	-0.804049	2.602839e-49	-8.615850e-47
Msa0098340	Msa1166090	-0.828503	8.669520e-55	-8.615850e-47
Msa0101830	Msa1166090	-0.802659	5.050178e-49	-8.615850e-47
Msa0103480	Msa1166090	-0.806507	7.954322e-50	-8.615850e-47
Msa0103790	Msa1166090	-0.821478	3.952010e-53	-8.615850e-47
Msa0104230	Msa1166090	-0.832099	1.146563e-55	-8.615850e-47
Msa0104240	Msa1166090	-0.802991	4.313705e-49	-8.615850e-47
Msa0104800	Msa1166090	-0.813274	2.780558e-51	-8.615850e-47
Msa0106850	Msa1166090	-0.805690	1.182033e-49	-8.615850e-47
Msa0108140	Msa1166090	-0.813144	2.969525e-51	-8.615850e-47
Msa0109590	Msa1166090	-0.823948	1.051953e-53	-8.615850e-47
Msa0111080	Msa1166090	-0.826009	3.430801e-54	-8.615850e-47
Msa0115190	Msa1166090	-0.834051	3.746756e-56	-8.615850e-47
Msa0118540	Msa1166090	-0.876993	8.975264e-69	-8.615850e-47
Msa0604290	Msa1166090	-0.868122	8.253297e-66	-8.615850e-47
Msa0608710	Msa1166090	-0.819196	1.318517e-52	-8.615850e-47
Msa0610130	Msa1166090	-0.859025	5.500476e-63	-8.615850e-47
Msa0610180	Msa1166090	-0.850001	2.250951e-60	-8.615850e-47
Msa0620330	Msa1166090	-0.814948	1.187798e-51	-8.615850e-47
Msa0621790	Msa1166090	-0.802449	5.579847e-49	-8.615850e-47
Msa0623990	Msa1166090	-0.820302	7.369959e-53	-8.615850e-47
Msa0624060	Msa1166090	-0.835844	1.324696e-56	-8.615850e-47
Msa0625700	Msa1166090	-0.806386	8.435308e-50	-8.615850e-47
Msa0629240	Msa1166090	-0.814141	1.792180e-51	-8.615850e-47
Msa0631350	Msa1166090	-0.819277	1.264101e-52	-8.615850e-47
Msa0634890	Msa1166090	-0.805488	1.302909e-49	-8.615850e-47
Msa0640940	Msa1166090	-0.833687	4.620626e-56	-8.615850e-47
Msa0643320	Msa1166090	-0.833680	4.640756e-56	-8.615850e-47
Msa0649220	Msa1166090	-0.815459	9.145204e-52	-8.615850e-47
Msa0649350	Msa1166090	-0.802679	5.004343e-49	-8.615850e-47
Msa0654620	Msa1166090	-0.858412	8.387275e-63	-8.615850e-47
Msa0657120	Msa1166090	-0.814070	1.857618e-51	-8.615850e-47
Msa0659210	Msa1166090	-0.814799	1.281905e-51	-8.615850e-47
Msa0662540	Msa1166090	-0.811518	6.724644e-51	-8.615850e-47
Msa0667740	Msa1166090	-0.810835	9.461085e-51	-8.615850e-47
Msa0672550	Msa1166090	-0.821215	4.545200e-53	-8.615850e-47
Msa0676130	Msa1166090	-0.825107	5.614120e-54	-8.615850e-47
Msa0676180	Msa1166090	-0.815483	9.032640e-52	-8.615850e-47
Msa0679360	Msa1166090	-0.844429	7.600544e-59	-8.615850e-47
Msa0679550	Msa1166090	-0.821454	4.002965e-53	-8.615850e-47
Msa0680480	Msa1166090	-0.819866	9.273082e-53	-8.615850e-47
Msa0682680	Msa1166090	-0.829017	6.511041e-55	-8.615850e-47
Msa0683140	Msa1166090	-0.832229	1.064913e-55	-8.615850e-47
Msa0683600	Msa1166090	-0.851578	8.100956e-61	-8.615850e-47
Msa0685090	Msa1166090	-0.807588	4.698018e-50	-8.615850e-47
Msa0689320	Msa1166090	-0.841752	3.927720e-58	-8.615850e-47
Msa0689780	Msa1166090	-0.853531	2.246513e-61	-8.615850e-47
Msa0693790	Msa1166090	-0.803542	3.316601e-49	-8.615850e-47
Msa0698410	Msa1166090	-0.820817	5.612968e-53	-8.615850e-47
Msa0701100	Msa1166090	-0.832627	8.488225e-56	-8.615850e-47
Msa0703910	Msa1166090	-0.855774	5.035269e-62	-8.615850e-47
Msa0705190	Msa1166090	-0.803887	2.812827e-49	-8.615850e-47
Msa0705820	Msa1166090	-0.817540	3.127716e-52	-8.615850e-47
Msa0705990	Msa1166090	-0.866209	3.369953e-65	-8.615850e-47
Msa0709120	Msa1166090	-0.813241	2.827158e-51	-8.615850e-47
Msa0709160	Msa1166090	-0.815951	7.106840e-52	-8.615850e-47
Msa0711100	Msa1166090	-0.825965	3.516100e-54	-8.615850e-47
Msa0711150	Msa1166090	-0.823586	1.279280e-53	-8.615850e-47
Msa0715410	Msa1166090	-0.813240	2.828526e-51	-8.615850e-47
Msa0719180	Msa1166090	-0.825887	3.667882e-54	-8.615850e-47
Msa0721340	Msa1166090	-0.824672	7.108894e-54	-8.615850e-47
Msa0724170	Msa1166090	-0.827685	1.364916e-54	-8.615850e-47
Msa0726080	Msa1166090	-0.805099	1.571941e-49	-8.615850e-47
Msa0732600	Msa1166090	-0.801885	7.289392e-49	-8.615850e-47
Msa0738030	Msa1166090	-0.824717	6.938164e-54	-8.615850e-47
Msa0741070	Msa1166090	-0.814126	1.806015e-51	-8.615850e-47
Msa0741440	Msa1166090	-0.836323	1.000678e-56	-8.615850e-47
Msa0742150	Msa1166090	-0.812035	5.192430e-51	-8.615850e-47
Msa0746170	Msa1166090	-0.880653	4.599172e-70	-8.615850e-47
Msa0746210	Msa1166090	-0.883117	5.882969e-71	-8.615850e-47
Msa0747630	Msa1166090	-0.815443	9.222862e-52	-8.615850e-47
Msa0748170	Msa1166090	-0.830954	2.195495e-55	-8.615850e-47
Msa0749440	Msa1166090	-0.859293	4.570669e-63	-8.615850e-47
Msa0750850	Msa1166090	-0.884915	1.275252e-71	-8.615850e-47
Msa0751850	Msa1166090	-0.857377	1.701935e-62	-8.615850e-47
Msa0753990	Msa1166090	0.812697	3.720557e-51	-8.615850e-47
Msa0760350	Msa1166090	-0.816608	5.067013e-52	-8.615850e-47
Msa0763890	Msa1166090	-0.823992	1.027311e-53	-8.615850e-47
Msa0763920	Msa1166090	-0.831417	1.689575e-55	-8.615850e-47
Msa0764920	Msa1166090	-0.815340	9.721948e-52	-8.615850e-47
Msa0765180	Msa1166090	-0.846048	2.774264e-59	-8.615850e-47
Msa0767370	Msa1166090	-0.850937	1.229081e-60	-8.615850e-47
Msa0769970	Msa1166090	-0.809342	1.983926e-50	-8.615850e-47
Msa0783960	Msa1166090	-0.826164	3.153179e-54	-8.615850e-47
Msa0784480	Msa1166090	-0.817435	3.302988e-52	-8.615850e-47
Msa0788540	Msa1166090	-0.837929	3.889501e-57	-8.615850e-47
Msa0790820	Msa1166090	0.810139	1.336941e-50	-8.615850e-47
Msa0793380	Msa1166090	-0.820183	7.849298e-53	-8.615850e-47
Msa0800370	Msa1166090	-0.828456	8.902215e-55	-8.615850e-47
Msa0800460	Msa1166090	-0.823426	1.393999e-53	-8.615850e-47
Msa0801730	Msa1166090	-0.831594	1.528320e-55	-8.615850e-47
Msa0805420	Msa1166090	-0.828448	8.940223e-55	-8.615850e-47
Msa0817120	Msa1166090	-0.806096	9.710871e-50	-8.615850e-47
Msa0817460	Msa1166090	-0.813634	2.317603e-51	-8.615850e-47
Msa0818060	Msa1166090	-0.803689	3.091542e-49	-8.615850e-47
Msa0820850	Msa1166090	-0.817009	4.117641e-52	-8.615850e-47
Msa0822500	Msa1166090	-0.844656	6.604420e-59	-8.615850e-47
Msa0826150	Msa1166090	-0.822118	2.810455e-53	-8.615850e-47
Msa0827350	Msa1166090	0.801544	8.566306e-49	-8.615850e-47
Msa0829220	Msa1166090	-0.834476	2.932304e-56	-8.615850e-47
Msa0830230	Msa1166090	-0.819317	1.237652e-52	-8.615850e-47
Msa0831130	Msa1166090	-0.807016	6.210284e-50	-8.615850e-47
Msa0831850	Msa1166090	-0.842080	3.215801e-58	-8.615850e-47
Msa0832150	Msa1166090	-0.830271	3.226320e-55	-8.615850e-47
Msa0833460	Msa1166090	-0.815483	9.032640e-52	-8.615850e-47
Msa0837780	Msa1166090	-0.814135	1.797131e-51	-8.615850e-47
Msa0124550	Msa1166090	-0.813519	2.457349e-51	-8.615850e-47
Msa0127780	Msa1166090	-0.800870	1.176809e-48	-8.615850e-47
Msa0129190	Msa1166090	0.830247	3.270648e-55	-8.615850e-47
Msa0130520	Msa1166090	-0.829323	5.488152e-55	-8.615850e-47
Msa0130720	Msa1166090	-0.807592	4.688139e-50	-8.615850e-47
Msa0135410	Msa1166090	-0.844089	9.378637e-59	-8.615850e-47
Msa0137710	Msa1166090	0.800914	1.152540e-48	-8.615850e-47
Msa0138020	Msa1166090	-0.864489	1.172352e-64	-8.615850e-47
Msa0139670	Msa1166090	-0.813909	2.016063e-51	-8.615850e-47
Msa0140500	Msa1166090	0.802719	4.910118e-49	-8.615850e-47
Msa0140510	Msa1166090	0.814483	1.505522e-51	-8.615850e-47
Msa0142500	Msa1166090	-0.851897	6.577032e-61	-8.615850e-47
Msa0145010	Msa1166090	-0.802771	4.788634e-49	-8.615850e-47
Msa0148080	Msa1166090	-0.831237	1.871011e-55	-8.615850e-47
Msa0150230	Msa1166090	-0.858499	7.901559e-63	-8.615850e-47
Msa0152560	Msa1166090	-0.816740	4.732608e-52	-8.615850e-47
Msa0154920	Msa1166090	-0.828403	9.167807e-55	-8.615850e-47
Msa0155340	Msa1166090	-0.824122	9.575439e-54	-8.615850e-47
Msa0156700	Msa1166090	-0.814141	1.792195e-51	-8.615850e-47
Msa0159420	Msa1166090	-0.817425	3.319301e-52	-8.615850e-47
Msa0160960	Msa1166090	-0.838231	3.252525e-57	-8.615850e-47
Msa0162130	Msa1166090	-0.819322	1.234305e-52	-8.615850e-47
Msa0167980	Msa1166090	-0.840078	1.079760e-57	-8.615850e-47
Msa0171870	Msa1166090	-0.801833	7.470695e-49	-8.615850e-47
Msa0172000	Msa1166090	-0.812819	3.499034e-51	-8.615850e-47
Msa0175540	Msa1166090	-0.829378	5.323693e-55	-8.615850e-47
Msa0178510	Msa1166090	-0.825266	5.149202e-54	-8.615850e-47
Msa0178570	Msa1166090	-0.811707	6.118949e-51	-8.615850e-47
Msa0178800	Msa1166090	-0.818602	1.799609e-52	-8.615850e-47
Msa0180510	Msa1166090	0.849810	2.546414e-60	-8.615850e-47
Msa0183850	Msa1166090	-0.817694	2.887913e-52	-8.615850e-47
Msa0183870	Msa1166090	-0.854652	1.067015e-61	-8.615850e-47
Msa0186950	Msa1166090	-0.830257	3.252167e-55	-8.615850e-47
Msa0187230	Msa1166090	-0.802252	6.128312e-49	-8.615850e-47
Msa0187490	Msa1166090	-0.830545	2.764787e-55	-8.615850e-47
Msa0189030	Msa1166090	-0.839369	1.651412e-57	-8.615850e-47
Msa0189520	Msa1166090	-0.842720	2.176300e-58	-8.615850e-47
Msa0190120	Msa1166090	-0.820250	7.573564e-53	-8.615850e-47
Msa0190590	Msa1166090	-0.811264	7.636758e-51	-8.615850e-47
Msa0191070	Msa1166090	-0.823878	1.092900e-53	-8.615850e-47
Msa0196670	Msa1166090	-0.834103	3.636814e-56	-8.615850e-47
Msa0197610	Msa1166090	-0.849980	2.282347e-60	-8.615850e-47
Msa0197650	Msa1166090	-0.806998	6.263495e-50	-8.615850e-47
Msa0202930	Msa1166090	-0.825369	4.867828e-54	-8.615850e-47
Msa0204960	Msa1166090	-0.827258	1.727912e-54	-8.615850e-47
Msa0207030	Msa1166090	-0.812860	3.427970e-51	-8.615850e-47
Msa0207040	Msa1166090	0.845895	3.053339e-59	-8.615850e-47
Msa0207670	Msa1166090	-0.806065	9.856942e-50	-8.615850e-47
Msa0217290	Msa1166090	-0.808513	2.984305e-50	-8.615850e-47
Msa0217680	Msa1166090	-0.822325	2.516847e-53	-8.615850e-47
Msa0218370	Msa1166090	-0.826336	2.868868e-54	-8.615850e-47
Msa0223120	Msa1166090	-0.808597	2.864744e-50	-8.615850e-47
Msa0223330	Msa1166090	-0.816532	5.267325e-52	-8.615850e-47
Msa0223340	Msa1166090	-0.811991	5.307593e-51	-8.615850e-47
Msa0231790	Msa1166090	-0.820126	8.087816e-53	-8.615850e-47
Msa0233370	Msa1166090	-0.850339	1.810548e-60	-8.615850e-47
Msa0236420	Msa1166090	-0.837321	5.569195e-57	-8.615850e-47
Msa0365860	Msa1166090	-0.808643	2.800121e-50	-8.615850e-47
Msa0366210	Msa1166090	-0.840368	9.070069e-58	-8.615850e-47
Msa0369920	Msa1166090	-0.805418	1.348037e-49	-8.615850e-47
Msa0371950	Msa1166090	-0.831205	1.904652e-55	-8.615850e-47
Msa0376910	Msa1166090	-0.824078	9.807353e-54	-8.615850e-47
Msa0379690	Msa1166090	-0.847476	1.129208e-59	-8.615850e-47
Msa0380100	Msa1166090	-0.875529	2.867695e-68	-8.615850e-47
Msa0382370	Msa1166090	-0.819084	1.398288e-52	-8.615850e-47
Msa0383800	Msa1166090	-0.816772	4.653741e-52	-8.615850e-47
Msa0385490	Msa1166090	-0.865407	6.039995e-65	-8.615850e-47
Msa0385500	Msa1166090	-0.846314	2.348523e-59	-8.615850e-47
Msa0387050	Msa1166090	-0.809560	1.781647e-50	-8.615850e-47
Msa0388730	Msa1166090	-0.873881	1.042950e-67	-8.615850e-47
Msa0389210	Msa1166090	-0.841145	5.675608e-58	-8.615850e-47
Msa0389610	Msa1166090	0.856332	3.454895e-62	-8.615850e-47
Msa0392270	Msa1166090	-0.801054	1.079167e-48	-8.615850e-47
Msa0394340	Msa1166090	-0.838546	2.696255e-57	-8.615850e-47
Msa0394470	Msa1166090	-0.816963	4.217689e-52	-8.615850e-47
Msa0395980	Msa1166090	-0.807848	4.135467e-50	-8.615850e-47
Msa0397270	Msa1166090	-0.823350	1.452391e-53	-8.615850e-47
Msa0403770	Msa1166090	-0.870854	1.065122e-66	-8.615850e-47
Msa0408390	Msa1166090	-0.832061	1.171488e-55	-8.615850e-47
Msa0412840	Msa1166090	-0.833404	5.437904e-56	-8.615850e-47
Msa0414140	Msa1166090	-0.830069	3.614532e-55	-8.615850e-47
Msa0417330	Msa1166090	-0.836283	1.024569e-56	-8.615850e-47
Msa0422180	Msa1166090	-0.805962	1.036255e-49	-8.615850e-47
Msa0427580	Msa1166090	-0.811721	6.075493e-51	-8.615850e-47
Msa0432160	Msa1166090	-0.817680	2.908767e-52	-8.615850e-47
Msa0432500	Msa1166090	-0.843665	1.218616e-58	-8.615850e-47
Msa0434180	Msa1166090	-0.827969	1.166574e-54	-8.615850e-47
Msa0438040	Msa1166090	-0.806392	8.409562e-50	-8.615850e-47
Msa0442200	Msa1166090	-0.802340	5.878228e-49	-8.615850e-47
Msa0442610	Msa1166090	-0.808798	2.594454e-50	-8.615850e-47
Msa0455590	Msa1166090	-0.812976	3.233311e-51	-8.615850e-47
Msa0457510	Msa1166090	-0.848326	6.581778e-60	-8.615850e-47
Msa0460400	Msa1166090	0.817822	2.701437e-52	-8.615850e-47
Msa0468320	Msa1166090	-0.821418	4.081085e-53	-8.615850e-47
Msa0469620	Msa1166090	0.840079	1.078944e-57	-8.615850e-47
Msa0471900	Msa1166090	-0.818864	1.568790e-52	-8.615850e-47
Msa0472960	Msa1166090	0.873621	1.275818e-67	-8.615850e-47
Msa0476680	Msa1166090	-0.821491	3.925632e-53	-8.615850e-47
Msa0477260	Msa1166090	-0.803989	2.678302e-49	-8.615850e-47
Msa0481280	Msa1166090	-0.845943	2.961907e-59	-8.615850e-47
Msa0482040	Msa1166090	-0.807536	4.818098e-50	-8.615850e-47
Msa0980020	Msa1166090	-0.821071	4.905001e-53	-8.615850e-47
Msa0980540	Msa1166090	-0.810798	9.635489e-51	-8.615850e-47
Msa0981840	Msa1166090	-0.827393	1.603619e-54	-8.615850e-47
Msa0985180	Msa1166090	-0.825291	5.079381e-54	-8.615850e-47
Msa0987370	Msa1166090	-0.800627	1.319058e-48	-8.615850e-47
Msa0990580	Msa1166090	-0.805987	1.023678e-49	-8.615850e-47
Msa0992580	Msa1166090	-0.834423	3.023373e-56	-8.615850e-47
Msa0992600	Msa1166090	-0.846757	1.777406e-59	-8.615850e-47
Msa0994370	Msa1166090	-0.883267	5.185046e-71	-8.615850e-47
Msa0994910	Msa1166090	-0.814608	1.412558e-51	-8.615850e-47
Msa1006010	Msa1166090	0.801157	1.027945e-48	-8.615850e-47
Msa1011090	Msa1166090	-0.805264	1.451769e-49	-8.615850e-47
Msa1018040	Msa1166090	-0.822133	2.787869e-53	-8.615850e-47
Msa1023180	Msa1166090	-0.830211	3.336150e-55	-8.615850e-47
Msa1023310	Msa1166090	-0.804850	1.772457e-49	-8.615850e-47
Msa1024680	Msa1166090	-0.825751	3.952512e-54	-8.615850e-47
Msa1025080	Msa1166090	-0.868090	8.454674e-66	-8.615850e-47
Msa1026640	Msa1166090	-0.827618	1.416239e-54	-8.615850e-47
Msa1026940	Msa1166090	-0.805764	1.140314e-49	-8.615850e-47
Msa1029050	Msa1166090	-0.816843	4.485899e-52	-8.615850e-47
Msa1029060	Msa1166090	0.819961	8.823136e-53	-8.615850e-47
Msa1029080	Msa1166090	0.846953	1.570490e-59	-8.615850e-47
Msa1032770	Msa1166090	-0.804077	2.568311e-49	-8.615850e-47
Msa1034150	Msa1166090	-0.823738	1.178527e-53	-8.615850e-47
Msa1036800	Msa1166090	-0.810311	1.227943e-50	-8.615850e-47
Msa1037520	Msa1166090	-0.837577	4.789421e-57	-8.615850e-47
Msa1042660	Msa1166090	-0.841228	5.397107e-58	-8.615850e-47
Msa1043050	Msa1166090	-0.831603	1.520108e-55	-8.615850e-47
Msa1043250	Msa1166090	0.814274	1.674572e-51	-8.615850e-47
Msa1051850	Msa1166090	-0.846078	2.721736e-59	-8.615850e-47
Msa1054150	Msa1166090	0.834240	3.359796e-56	-8.615850e-47
Msa1058170	Msa1166090	-0.802112	6.548793e-49	-8.615850e-47
Msa1059470	Msa1166090	-0.813301	2.743796e-51	-8.615850e-47
Msa1062030	Msa1166090	-0.804110	2.527714e-49	-8.615850e-47
Msa1062040	Msa1166090	-0.832516	9.039368e-56	-8.615850e-47
Msa1063420	Msa1166090	-0.867742	1.093375e-65	-8.615850e-47
Msa1063510	Msa1166090	-0.816666	4.915275e-52	-8.615850e-47
Msa1063690	Msa1166090	-0.829119	6.153073e-55	-8.615850e-47
Msa1064250	Msa1166090	-0.817835	2.683809e-52	-8.615850e-47
Msa1068870	Msa1166090	-0.829608	4.680172e-55	-8.615850e-47
Msa1071320	Msa1166090	-0.887871	9.751379e-73	-8.615850e-47
Msa1072900	Msa1166090	-0.850325	1.826823e-60	-8.615850e-47
Msa1076960	Msa1166090	-0.812565	3.976254e-51	-8.615850e-47
Msa1077340	Msa1166090	-0.842176	3.033624e-58	-8.615850e-47
Msa1080270	Msa1166090	-0.801725	7.863124e-49	-8.615850e-47
Msa1080330	Msa1166090	0.847822	9.065233e-60	-8.615850e-47
Msa1081790	Msa1166090	0.986392	1.238420e-166	-8.615850e-47
Msa1087990	Msa1166090	-0.830372	3.047837e-55	-8.615850e-47
Msa1089320	Msa1166090	-0.832262	1.045227e-55	-8.615850e-47
Msa1089460	Msa1166090	-0.855360	6.645913e-62	-8.615850e-47
Msa1093100	Msa1166090	-0.820988	5.126024e-53	-8.615850e-47
Msa1096070	Msa1166090	-0.834837	2.378579e-56	-8.615850e-47
Msa1096950	Msa1166090	-0.860211	2.418998e-63	-8.615850e-47
Msa1100130	Msa1166090	0.834323	3.202310e-56	-8.615850e-47
Msa1103660	Msa1166090	0.802642	5.092655e-49	-8.615850e-47
Msa1104560	Msa1166090	-0.816880	4.402026e-52	-8.615850e-47
Msa1107190	Msa1166090	-0.806716	7.186950e-50	-8.615850e-47
Msa0241140	Msa1166090	-0.854452	1.219357e-61	-8.615850e-47
Msa0244970	Msa1166090	-0.801435	9.015523e-49	-8.615850e-47
Msa0244980	Msa1166090	-0.829491	4.997339e-55	-8.615850e-47
Msa0256330	Msa1166090	-0.829968	3.825634e-55	-8.615850e-47
Msa0257490	Msa1166090	-0.832817	7.612024e-56	-8.615850e-47
Msa0257500	Msa1166090	-0.849558	2.994068e-60	-8.615850e-47
Msa0262370	Msa1166090	-0.814745	1.317329e-51	-8.615850e-47
Msa0270960	Msa1166090	-0.835622	1.507502e-56	-8.615850e-47
Msa0271360	Msa1166090	-0.826091	3.280873e-54	-8.615850e-47
Msa0271790	Msa1166090	-0.827361	1.632204e-54	-8.615850e-47
Msa0271890	Msa1166090	-0.830907	2.254777e-55	-8.615850e-47
Msa0272450	Msa1166090	-0.836148	1.108624e-56	-8.615850e-47
Msa0274040	Msa1166090	0.810032	1.409863e-50	-8.615850e-47
Msa0276100	Msa1166090	-0.804977	1.667206e-49	-8.615850e-47
Msa0278580	Msa1166090	-0.851841	6.824955e-61	-8.615850e-47
Msa0281530	Msa1166090	-0.821073	4.901726e-53	-8.615850e-47
Msa0283420	Msa1166090	-0.819065	1.412195e-52	-8.615850e-47
Msa0284450	Msa1166090	-0.836578	8.620779e-57	-8.615850e-47
Msa0285330	Msa1166090	-0.846065	2.743793e-59	-8.615850e-47
Msa0295330	Msa1166090	-0.838854	2.245882e-57	-8.615850e-47
Msa0296790	Msa1166090	-0.840743	7.235201e-58	-8.615850e-47
Msa0296820	Msa1166090	-0.809419	1.910039e-50	-8.615850e-47
Msa0296920	Msa1166090	-0.807882	4.067181e-50	-8.615850e-47
Msa0296980	Msa1166090	0.803492	3.397335e-49	-8.615850e-47
Msa0299660	Msa1166090	-0.847649	1.012114e-59	-8.615850e-47
Msa0305410	Msa1166090	-0.839468	1.556025e-57	-8.615850e-47
Msa0307310	Msa1166090	-0.819200	1.315908e-52	-8.615850e-47
Msa0309270	Msa1166090	-0.849412	3.287918e-60	-8.615850e-47
Msa0309880	Msa1166090	-0.806476	8.076426e-50	-8.615850e-47
Msa0310430	Msa1166090	-0.831340	1.764739e-55	-8.615850e-47
Msa0310860	Msa1166090	-0.833720	4.534391e-56	-8.615850e-47
Msa0311720	Msa1166090	-0.809969	1.454580e-50	-8.615850e-47
Msa0317520	Msa1166090	-0.800817	1.206295e-48	-8.615850e-47
Msa0317960	Msa1166090	-0.849930	2.357393e-60	-8.615850e-47
Msa0319170	Msa1166090	-0.803632	3.177629e-49	-8.615850e-47
Msa0320670	Msa1166090	-0.833219	6.048697e-56	-8.615850e-47
Msa0321690	Msa1166090	-0.841375	4.936208e-58	-8.615850e-47
Msa0322680	Msa1166090	-0.803467	3.438427e-49	-8.615850e-47
Msa0324240	Msa1166090	-0.802989	4.316811e-49	-8.615850e-47
Msa0335060	Msa1166090	-0.835130	2.007630e-56	-8.615850e-47
Msa0335820	Msa1166090	0.800900	1.160074e-48	-8.615850e-47
Msa0337590	Msa1166090	-0.809784	1.594323e-50	-8.615850e-47
Msa0339910	Msa1166090	-0.800123	1.670528e-48	-8.615850e-47
Msa0343850	Msa1166090	-0.840093	1.069908e-57	-8.615850e-47
Msa0347610	Msa1166090	-0.812922	3.322894e-51	-8.615850e-47
Msa0347750	Msa1166090	-0.863038	3.310736e-64	-8.615850e-47
Msa0357790	Msa1166090	-0.800219	1.596812e-48	-8.615850e-47
Msa0358860	Msa1166090	-0.882643	8.774016e-71	-8.615850e-47
Msa0361490	Msa1166090	-0.804707	1.898018e-49	-8.615850e-47
Msa0363640	Msa1166090	-0.800948	1.134251e-48	-8.615850e-47
Msa1107200	Msa1166090	-0.835223	1.901398e-56	-8.615850e-47
Msa1108710	Msa1166090	-0.817084	3.962059e-52	-8.615850e-47
Msa1109090	Msa1166090	-0.843426	1.411938e-58	-8.615850e-47
Msa1109680	Msa1166090	-0.838699	2.461848e-57	-8.615850e-47
Msa1111870	Msa1166090	-0.801582	8.410853e-49	-8.615850e-47
Msa1113230	Msa1166090	0.810524	1.104664e-50	-8.615850e-47
Msa1115280	Msa1166090	-0.826704	2.344065e-54	-8.615850e-47
Msa1122860	Msa1166090	-0.804590	2.007873e-49	-8.615850e-47
Msa1123710	Msa1166090	0.812007	5.264167e-51	-8.615850e-47
Msa1127080	Msa1166090	0.858127	1.019433e-62	-8.615850e-47
Msa1130400	Msa1166090	-0.817662	2.935525e-52	-8.615850e-47
Msa1133230	Msa1166090	-0.868785	5.044517e-66	-8.615850e-47
Msa1133250	Msa1166090	-0.849206	3.751118e-60	-8.615850e-47
Msa1140230	Msa1166090	-0.876290	1.570285e-68	-8.615850e-47
Msa1143020	Msa1166090	-0.805154	1.530520e-49	-8.615850e-47
Msa1144040	Msa1166090	-0.845841	3.157110e-59	-8.615850e-47
Msa1150710	Msa1166090	-0.829714	4.410848e-55	-8.615850e-47
Msa1150780	Msa1166090	-0.822242	2.631098e-53	-8.615850e-47
Msa1152920	Msa1166090	-0.834655	2.644345e-56	-8.615850e-47
Msa1156150	Msa1166090	0.848005	8.073034e-60	-8.615850e-47
Msa1156170	Msa1166090	0.846232	2.472284e-59	-8.615850e-47
Msa1158640	Msa1166090	0.847363	1.212858e-59	-8.615850e-47
Msa1163590	Msa1166090	0.802687	4.984133e-49	-8.615850e-47
Msa1164020	Msa1166090	-0.802704	4.945509e-49	-8.615850e-47
Msa1166090	Msa1169850	0.829006	6.552344e-55	-8.615850e-47
Msa1166090	Msa1176360	-0.800187	1.621313e-48	-8.615850e-47
Msa1166090	Msa1176710	-0.832984	6.920705e-56	-8.615850e-47
Msa1166090	Msa1176720	-0.853999	1.648112e-61	-8.615850e-47
Msa1166090	Msa1177780	-0.830830	2.354744e-55	-8.615850e-47
Msa1166090	Msa1178060	-0.805901	1.067032e-49	-8.615850e-47
Msa1166090	Msa1178580	-0.828320	9.601070e-55	-8.615850e-47
Msa1166090	Msa1180500	-0.829925	3.917322e-55	-8.615850e-47
Msa1166090	Msa1181250	-0.828296	9.726823e-55	-8.615850e-47
Msa1166090	Msa1181330	-0.822867	1.882631e-53	-8.615850e-47
Msa1166090	Msa1184690	-0.800369	1.488928e-48	-8.615850e-47
Msa1166090	Msa1185460	-0.816942	4.263138e-52	-8.615850e-47
Msa1166090	Msa1188600	0.844980	5.402023e-59	-8.615850e-47
Msa1166090	Msa1191050	0.812590	3.926695e-51	-8.615850e-47
Msa1166090	Msa1196540	0.810736	9.936278e-51	-8.615850e-47
Msa1166090	Msa1196610	0.834184	3.471538e-56	-8.615850e-47
Msa1166090	Msa1200250	-0.812966	3.249710e-51	-8.615850e-47
Msa1166090	Msa1200320	-0.818122	2.311343e-52	-8.615850e-47
Msa1166090	Msa1202660	-0.838540	2.706366e-57	-8.615850e-47
Msa1166090	Msa1205590	-0.807775	4.286008e-50	-8.615850e-47
Msa1166090	Msa1206270	-0.827066	1.920221e-54	-8.615850e-47
Msa1166090	Msa1206290	-0.807429	5.076672e-50	-8.615850e-47
Msa1166090	Msa1206310	-0.805138	1.542827e-49	-8.615850e-47
Msa1166090	Msa1206360	-0.816958	4.229135e-52	-8.615850e-47
Msa1166090	Msa1207310	-0.867805	1.043878e-65	-8.615850e-47
Msa1166090	Msa1207350	-0.852495	4.447227e-61	-8.615850e-47
Msa1166090	Msa1207470	0.828357	9.401680e-55	-8.615850e-47
Msa1166090	Msa1208380	-0.861190	1.220795e-63	-8.615850e-47
Msa1166090	Msa1218580	-0.878011	3.963266e-69	-8.615850e-47
Msa1166090	Msa1221330	-0.828716	7.703491e-55	-8.615850e-47
Msa1166090	Msa1231840	-0.868314	7.160807e-66	-8.615850e-47
Msa1166090	Msa1233850	-0.830414	2.976465e-55	-8.615850e-47
Msa1166090	Msa1238840	-0.806172	9.361112e-50	-8.615850e-47
Msa1166090	Msa1239780	-0.811391	7.166377e-51	-8.615850e-47
Msa1166090	Msa1240970	-0.829208	5.855243e-55	-8.615850e-47
Msa1166090	Msa1242580	0.844010	9.850457e-59	-8.615850e-47
Msa1166090	Msa1244720	0.804697	1.907232e-49	-8.615850e-47
Msa1166090	Msa1248830	-0.813728	2.210347e-51	-8.615850e-47
Msa1166090	Msa1250110	-0.857800	1.275222e-62	-8.615850e-47
Msa1166090	Msa1250730	-0.848786	4.909211e-60	-8.615850e-47
Msa1166090	Msa1257800	0.819991	8.683762e-53	-8.615850e-47
Msa1166090	Msa1259530	-0.814629	1.397515e-51	-8.615850e-47
Msa1166090	Msa1265280	-0.811712	6.102384e-51	-8.615850e-47
Msa1166090	Msa1270660	-0.880300	6.148237e-70	-8.615850e-47
Msa1166090	Msa1270730	-0.864366	1.280132e-64	-8.615850e-47
Msa1166090	Msa1271130	-0.827145	1.839350e-54	-8.615850e-47
Msa1166090	Msa1274560	-0.825409	4.762070e-54	-8.615850e-47
Msa1166090	Msa1276150	-0.829379	5.320722e-55	-8.615850e-47
Msa1166090	Msa1276340	-0.838144	3.422861e-57	-8.615850e-47
Msa1166090	Msa1276440	-0.807092	5.984692e-50	-8.615850e-47
Msa1166090	Msa1280320	-0.835871	1.303602e-56	-8.615850e-47
Msa1166090	Msa1280340	-0.834860	2.347806e-56	-8.615850e-47
Msa1166090	Msa1295330	-0.876467	1.364039e-68	-8.615850e-47
Msa1166090	Msa1295930	-0.801573	8.449962e-49	-8.615850e-47
Msa1166090	Msa1297530	-0.800756	1.241079e-48	-8.615850e-47
Msa1166090	Msa1305810	-0.830941	2.211880e-55	-8.615850e-47
Msa1166090	Msa1307180	-0.854665	1.058089e-61	-8.615850e-47
Msa1166090	Msa1307550	-0.801128	1.042188e-48	-8.615850e-47
Msa1166090	Msa1312520	-0.832283	1.032551e-55	-8.615850e-47
Msa1166090	Msa1316360	-0.871651	5.808468e-67	-8.615850e-47
Msa1166090	Msa1316440	-0.852578	4.210892e-61	-8.615850e-47
Msa1166090	Msa1316640	-0.806100	9.691659e-50	-8.615850e-47
Msa1166090	Msa1325860	0.811915	5.512652e-51	-8.615850e-47
Msa1166090	Msa1328520	-0.842821	2.045944e-58	-8.615850e-47
Msa1166090	Msa1329800	-0.811984	5.324390e-51	-8.615850e-47
Msa1166090	Msa1331320	-0.829952	3.859603e-55	-8.615850e-47
Msa1166090	Msa1331350	-0.826252	3.004689e-54	-8.615850e-47
Msa1166090	Msa1332050	-0.820107	8.168251e-53	-8.615850e-47
Msa1166090	Msa1335230	-0.852539	4.320470e-61	-8.615850e-47
Msa1166090	Msa1336560	-0.832029	1.193521e-55	-8.615850e-47
Msa1166090	Msa1337170	-0.813414	2.590580e-51	-8.615850e-47
Msa1166090	Msa1337480	-0.829239	5.753154e-55	-8.615850e-47
Msa1166090	Msa1339190	-0.823135	1.630088e-53	-8.615850e-47
Msa1166090	Msa1342100	-0.837954	3.830866e-57	-8.615850e-47
Msa1166090	Msa1344660	-0.802039	6.779252e-49	-8.615850e-47
Msa1166090	Msa1345940	-0.805417	1.348361e-49	-8.615850e-47
Msa1166090	Msa1346840	-0.859994	2.813791e-63	-8.615850e-47
Msa1166090	Msa1352890	-0.810565	1.082060e-50	-8.615850e-47
Msa1166090	Msa1355180	-0.806371	8.497417e-50	-8.615850e-47
Msa1166090	Msa1355890	-0.868334	7.055353e-66	-8.615850e-47
Msa1166090	Msa1357430	-0.810395	1.177522e-50	-8.615850e-47
Msa1166090	Msa1357890	-0.802873	4.563514e-49	-8.615850e-47
Msa1166090	Msa1359270	-0.814874	1.233514e-51	-8.615850e-47
Msa1166090	Msa1359630	-0.804627	1.972985e-49	-8.615850e-47
Msa1166090	Msa1364210	-0.832238	1.059577e-55	-8.615850e-47
Msa1166090	Msa1370590	-0.847132	1.402949e-59	-8.615850e-47
Msa1166090	Msa1371090	-0.822889	1.860530e-53	-8.615850e-47
Msa1166090	Msa1371240	-0.827161	1.822825e-54	-8.615850e-47
Msa1166090	Msa1371940	-0.858654	7.103719e-63	-8.615850e-47
Msa1166090	Msa1372150	-0.821207	4.565430e-53	-8.615850e-47
Msa1166090	Msa1372240	-0.803321	3.686627e-49	-8.615850e-47
Msa1166090	Msa1372290	-0.839346	1.673941e-57	-8.615850e-47
Msa1166090	Msa1376130	-0.823510	1.332588e-53	-8.615850e-47
Msa1166090	Msa1377570	-0.822804	1.946662e-53	-8.615850e-47
Msa1166090	Msa1378410	-0.832733	7.988307e-56	-8.615850e-47
Msa1166090	Msa1382020	-0.830399	3.002083e-55	-8.615850e-47
Msa1166090	Msa1382790	-0.828900	6.950536e-55	-8.615850e-47
Msa1166090	Msa1384100	-0.846259	2.429690e-59	-8.615850e-47
Msa1166090	Msa1386050	-0.819481	1.135601e-52	-8.615850e-47
Msa1166090	Msa1388830	-0.807275	5.472231e-50	-8.615850e-47
Msa1166090	Msa1388860	-0.855647	5.481461e-62	-8.615850e-47
Msa1166090	Msa1394310	-0.835039	2.115617e-56	-8.615850e-47
Msa1166090	Msa1395730	-0.810813	9.563208e-51	-8.615850e-47
Msa1166090	Msa1396400	0.999094	6.367718e-290	-8.615850e-47
Msa1166090	Msa1397120	-0.800553	1.365487e-48	-8.615850e-47
Msa1166090	Msa1401990	-0.868887	4.675105e-66	-8.615850e-47
Msa1166090	Msa1403340	-0.832014	1.203829e-55	-8.615850e-47
Msa1166090	Msa1403890	-0.800142	1.655381e-48	-8.615850e-47
Msa1166090	Msa1406110	0.851642	7.768675e-61	-8.615850e-47
Msa1166090	Msa1407190	-0.829800	4.201991e-55	-8.615850e-47
Msa1166090	Msa1407470	-0.805054	1.606652e-49	-8.615850e-47
Msa1166090	Msa1407760	-0.823559	1.297761e-53	-8.615850e-47
Msa1166090	Msa1410550	-0.804566	2.031890e-49	-8.615850e-47
Msa1166090	Msa1412070	-0.801750	7.772212e-49	-8.615850e-47
Msa1166090	Msa1412890	-0.822374	2.451614e-53	-8.615850e-47
Msa1166090	Msa1417810	0.807241	5.563778e-50	-8.615850e-47
Msa1166090	Msa1419000	-0.805060	1.601786e-49	-8.615850e-47
Msa1166090	Msa1419640	-0.815862	7.436209e-52	-8.615850e-47
Msa1166090	Msa1419690	-0.804501	2.096018e-49	-8.615850e-47
Msa1166090	Msa1419840	-0.806165	9.392911e-50	-8.615850e-47
Msa1166090	Msa1420270	-0.863064	3.249622e-64	-8.615850e-47
Msa1166090	Msa1422810	-0.821455	4.001434e-53	-8.615850e-47
Msa1166090	Msa1423820	-0.842066	3.243946e-58	-8.615850e-47
Msa1166090	Msa1428780	-0.843610	1.260708e-58	-8.615850e-47
Msa1166090	Msa1428880	-0.800231	1.588363e-48	-8.615850e-47
Msa1166090	Msa1430130	-0.838360	3.012597e-57	-8.615850e-47
Msa1166090	Msa1432130	-0.817354	3.445164e-52	-8.615850e-47
Msa1166090	Msa1436520	-0.815249	1.018382e-51	-8.615850e-47
Msa1166090	Msa1436600	-0.876169	1.728526e-68	-8.615850e-47
Msa1166090	Msa1437130	-0.814075	1.852762e-51	-8.615850e-47
Msa1166090	Msa1437270	-0.814311	1.643744e-51	-8.615850e-47
Msa1166090	Msa1437730	-0.866159	3.494599e-65	-8.615850e-47
Msa1166090	Msa1437910	-0.850495	1.636119e-60	-8.615850e-47
Msa1166090	Msa1438840	-0.837383	5.370197e-57	-8.615850e-47
Msa1166090	Msa1442790	-0.850194	1.988031e-60	-8.615850e-47
Msa1166090	Msa1444120	-0.845359	4.266591e-59	-8.615850e-47
Msa1166090	Msa1444740	-0.828501	8.680628e-55	-8.615850e-47
Msa1166090	Msa1445390	0.800170	1.634468e-48	-8.615850e-47
Msa1166090	Msa1445400	0.810129	1.343642e-50	-8.615850e-47
Msa1166090	Msa1446080	-0.835653	1.480091e-56	-8.615850e-47
Msa1166090	Msa1447890	-0.835647	1.485534e-56	-8.615850e-47
Msa1166090	Msa1448630	-0.825025	5.869739e-54	-8.615850e-47
Msa1166090	Msa1449340	0.802306	5.973772e-49	-8.615850e-47
Msa1166090	Msa1449350	0.807151	5.815367e-50	-8.615850e-47
Msa1166090	Msa1454680	-0.809228	2.099430e-50	-8.615850e-47
Msa1166090	Msa1454890	-0.818634	1.769088e-52	-8.615850e-47
Msa1166090	Msa1454960	-0.803503	3.379402e-49	-8.615850e-47
Msa1166090	Msa1457160	-0.805008	1.642412e-49	-8.615850e-47
Msa1166090	Msa1458090	-0.809258	2.068338e-50	-8.615850e-47
Msa1166090	Msa1458290	-0.817386	3.387178e-52	-8.615850e-47
Msa1166090	Msa1460320	0.823807	1.135301e-53	-8.615850e-47
Msa1166090	Msa1460750	-0.838114	3.485576e-57	-8.615850e-47
Msa1166090	Msa1462290	-0.813537	2.433952e-51	-8.615850e-47
Msa1166090	Msa1462360	-0.804867	1.757489e-49	-8.615850e-47
Msa1166090	Msa1465610	0.855298	6.927426e-62	-8.615850e-47
Msa0482940	Msa1166090	-0.847820	9.079729e-60	-8.615850e-47
Msa0485490	Msa1166090	-0.814061	1.865933e-51	-8.615850e-47
Msa0485710	Msa1166090	-0.819590	1.072080e-52	-8.615850e-47
Msa0489610	Msa1166090	-0.830509	2.822269e-55	-8.615850e-47
Msa0489660	Msa1166090	-0.806332	8.658896e-50	-8.615850e-47
Msa0491000	Msa1166090	-0.824016	1.014116e-53	-8.615850e-47
Msa0496450	Msa1166090	-0.819407	1.180413e-52	-8.615850e-47
Msa0507610	Msa1166090	-0.809879	1.521444e-50	-8.615850e-47
Msa0518170	Msa1166090	-0.837949	3.842003e-57	-8.615850e-47
Msa0518380	Msa1166090	-0.819122	1.370880e-52	-8.615850e-47
Msa0521010	Msa1166090	-0.822061	2.896773e-53	-8.615850e-47
Msa0521270	Msa1166090	-0.804376	2.225279e-49	-8.615850e-47
Msa0524600	Msa1166090	-0.814211	1.729073e-51	-8.615850e-47
Msa0527540	Msa1166090	-0.815641	8.332251e-52	-8.615850e-47
Msa0527740	Msa1166090	-0.824929	6.183232e-54	-8.615850e-47
Msa0528610	Msa1166090	0.822312	2.533848e-53	-8.615850e-47
Msa0530290	Msa1166090	-0.810597	1.065240e-50	-8.615850e-47
Msa0530650	Msa1166090	-0.803002	4.290489e-49	-8.615850e-47
Msa0534870	Msa1166090	-0.806021	1.006934e-49	-8.615850e-47
Msa0534900	Msa1166090	-0.809006	2.341600e-50	-8.615850e-47
Msa0542290	Msa1166090	-0.829132	6.108562e-55	-8.615850e-47
Msa0542560	Msa1166090	-0.882321	1.148673e-70	-8.615850e-47
Msa0544160	Msa1166090	-0.807853	4.125279e-50	-8.615850e-47
Msa0544840	Msa1166090	-0.862037	6.730745e-64	-8.615850e-47
Msa0547160	Msa1166090	-0.810651	1.036913e-50	-8.615850e-47
Msa0549780	Msa1166090	-0.844178	8.881944e-59	-8.615850e-47
Msa0566350	Msa1166090	-0.862948	3.528117e-64	-8.615850e-47
Msa0566750	Msa1166090	-0.857170	1.958698e-62	-8.615850e-47
Msa0567240	Msa1166090	-0.803745	3.011009e-49	-8.615850e-47
Msa0569780	Msa1166090	-0.825567	4.368609e-54	-8.615850e-47
Msa0574060	Msa1166090	0.820094	8.223784e-53	-8.615850e-47
Msa0581400	Msa1166090	-0.809476	1.857281e-50	-8.615850e-47
Msa0587190	Msa1166090	-0.801988	6.944522e-49	-8.615850e-47
Msa0588240	Msa1166090	-0.815295	9.948045e-52	-8.615850e-47
Msa0588260	Msa1166090	-0.834822	2.399509e-56	-8.615850e-47
Msa0600080	Msa1166090	-0.852257	5.196620e-61	-8.615850e-47
Msa0600450	Msa1166090	-0.843429	1.408662e-58	-8.615850e-47
Msa0601390	Msa1166090	-0.824722	6.919305e-54	-8.615850e-47
Msa0602370	Msa1166090	-0.835632	1.498677e-56	-8.615850e-47
Msa0842770	Msa1166090	-0.842177	3.031297e-58	-8.615850e-47
Msa0844110	Msa1166090	-0.846864	1.661531e-59	-8.615850e-47
Msa0844610	Msa1166090	-0.807006	6.239941e-50	-8.615850e-47
Msa0846230	Msa1166090	-0.813167	2.935355e-51	-8.615850e-47
Msa0849030	Msa1166090	-0.805793	1.124715e-49	-8.615850e-47
Msa0860030	Msa1166090	0.829389	5.290827e-55	-8.615850e-47
Msa0861130	Msa1166090	-0.816498	5.361316e-52	-8.615850e-47
Msa0861470	Msa1166090	-0.877263	7.227670e-69	-8.615850e-47
Msa0861500	Msa1166090	-0.803942	2.740363e-49	-8.615850e-47
Msa0861570	Msa1166090	-0.882980	6.604904e-71	-8.615850e-47
Msa0865030	Msa1166090	-0.816197	6.259611e-52	-8.615850e-47
Msa0867520	Msa1166090	0.807264	5.502580e-50	-8.615850e-47
Msa0876360	Msa1166090	-0.815527	8.833912e-52	-8.615850e-47
Msa0877710	Msa1166090	-0.851712	7.425426e-61	-8.615850e-47
Msa0878220	Msa1166090	-0.829813	4.172811e-55	-8.615850e-47
Msa0880810	Msa1166090	-0.880057	7.509790e-70	-8.615850e-47
Msa0887250	Msa1166090	-0.813417	2.586915e-51	-8.615850e-47
Msa0888260	Msa1166090	-0.847037	1.489765e-59	-8.615850e-47
Msa0890550	Msa1166090	-0.829264	5.672330e-55	-8.615850e-47
Msa0894710	Msa1166090	-0.839335	1.685037e-57	-8.615850e-47
Msa0897200	Msa1166090	-0.836147	1.109393e-56	-8.615850e-47
Msa0901320	Msa1166090	-0.825735	3.985620e-54	-8.615850e-47
Msa0902830	Msa1166090	-0.831161	1.952755e-55	-8.615850e-47
Msa0905750	Msa1166090	-0.806734	7.123564e-50	-8.615850e-47
Msa0918390	Msa1166090	-0.813449	2.544719e-51	-8.615850e-47
Msa0921420	Msa1166090	-0.828424	9.058003e-55	-8.615850e-47
Msa0923780	Msa1166090	-0.811069	8.416171e-51	-8.615850e-47
Msa0924150	Msa1166090	0.805762	1.141704e-49	-8.615850e-47
Msa0925870	Msa1166090	-0.807224	5.611841e-50	-8.615850e-47
Msa0933380	Msa1166090	-0.817593	3.042612e-52	-8.615850e-47
Msa0935770	Msa1166090	-0.803080	4.134414e-49	-8.615850e-47
Msa0937330	Msa1166090	-0.822178	2.722638e-53	-8.615850e-47
Msa0943970	Msa1166090	-0.841111	5.792686e-58	-8.615850e-47
Msa0944020	Msa1166090	-0.835788	1.368231e-56	-8.615850e-47
Msa0944200	Msa1166090	-0.835874	1.301529e-56	-8.615850e-47
Msa0944870	Msa1166090	-0.801513	8.689395e-49	-8.615850e-47
Msa0946280	Msa1166090	0.838651	2.533762e-57	-8.615850e-47
Msa0958920	Msa1166090	-0.814195	1.743527e-51	-8.615850e-47
Msa0960390	Msa1166090	-0.838325	3.075579e-57	-8.615850e-47
Msa0962840	Msa1166090	-0.831428	1.678632e-55	-8.615850e-47
Msa0963090	Msa1166090	0.834397	3.069951e-56	-8.615850e-47
Msa0969370	Msa1166090	-0.822168	2.735865e-53	-8.615850e-47
Msa0971020	Msa1166090	-0.803281	3.756345e-49	-8.615850e-47
Msa0974630	Msa1166090	-0.811277	7.587889e-51	-8.615850e-47
Msa0974950	Msa1166090	-0.846491	2.100723e-59	-8.615850e-47
Msa0978700	Msa1166090	-0.802626	5.132172e-49	-8.615850e-47

PPI

Gene1	Gene2	Type

Query id	Subject id	identity %	alignment length	mismatches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa1166090	MtrunA17_Chr7g0269001	97.959	490	7	1	1	487	1	490	0.0	999
Msa1166090	MtrunA17_Chr8g0369451	26.690	281	168	6	235	478	4	283	1.69e-21	97.1
Msa1166090	MtrunA17_Chr5g0409421	26.042	288	171	7	228	478	1	283	2.36e-21	96.7
Msa1166090	MtrunA17_Chr1g0173921	29.730	259	161	12	234	476	3	256	3.85e-20	94.4
Msa1166090	MtrunA17_Chr2g0286501	31.373	255	151	10	235	472	49	296	3.86e-20	94.4
Msa1166090	MtrunA17_Chr8g0386981	32.950	261	148	14	241	481	414	667	1.34e-19	92.4
Msa1166090	MtrunA17_Chr4g0051191	28.682	258	169	10	241	485	169	424	1.39e-19	90.9
Msa1166090	MtrunA17_Chr8g0374701	29.670	273	144	11	239	476	129	388	2.22e-19	91.3
Msa1166090	MtrunA17_Chr1g0157131	27.757	263	155	9	239	476	78	330	2.31e-19	90.9
Msa1166090	MtrunA17_Chr4g0059951	26.648	349	211	12	161	485	11	338	4.00e-19	90.5
Msa1166090	MtrunA17_Chr4g0045261	29.304	273	142	10	239	476	141	397	4.69e-19	90.1
Msa1166090	MtrunA17_Chr7g0260191	30.859	256	160	10	235	476	4	256	5.83e-19	90.1
Msa1166090	MtrunA17_Chr5g0402551	29.930	284	151	13	227	476	125	394	1.39e-18	88.6
Msa1166090	MtrunA17_Chr1g0202831	32.061	262	149	13	241	481	417	670	1.74e-18	89.0
Msa1166090	MtrunA17_Chr7g0258051	30.075	266	161	12	229	476	10	268	5.72e-18	87.0
Msa1166090	MtrunA17_Chr1g0190831	30.859	256	160	11	235	476	4	256	2.49e-17	85.1
Msa1166090	MtrunA17_Chr5g0419441	27.376	263	172	9	233	480	237	495	2.50e-17	85.1
Msa1166090	MtrunA17_Chr6g0479211	28.464	267	166	11	234	478	55	318	2.96e-17	82.8
Msa1166090	MtrunA17_Chr3g0130151	29.167	264	166	11	232	478	241	500	3.82e-17	84.3
Msa1166090	MtrunA17_Chr7g0256001	28.763	299	155	14	227	486	132	411	4.59e-17	84.0
Msa1166090	MtrunA17_Chr5g0402601	26.894	264	171	9	232	475	369	630	1.70e-16	82.4
Msa1166090	MtrunA17_Chr4g0074811	26.996	263	157	10	239	476	95	347	1.97e-16	82.0
Msa1166090	MtrunA17_Chr8g0339221	23.611	288	181	5	238	487	7	293	2.45e-16	81.3
Msa1166090	MtrunA17_Chr7g0274941	31.179	263	160	13	232	476	13	272	2.97e-16	79.3
Msa1166090	MtrunA17_Chr8g0345801	27.488	211	134	7	228	425	8	212	4.72e-16	78.2
Msa1166090	MtrunA17_Chr1g0185221	28.516	256	166	10	235	476	4	256	1.09e-15	79.7
Msa1166090	MtrunA17_Chr1g0205421	27.652	264	162	11	239	482	16	270	1.30e-15	79.0
Msa1166090	MtrunA17_Chr1g0173541	26.568	271	167	10	240	487	57	318	1.32e-15	79.3
Msa1166090	MtrunA17_Chr1g0170551	28.346	254	165	10	235	476	7	255	1.78e-15	79.7
Msa1166090	MtrunA17_Chr2g0321841	29.278	263	158	12	234	476	2	256	4.96e-15	78.2
Msa1166090	MtrunA17_Chr3g0114511	27.509	269	162	9	239	486	36	292	1.49e-14	75.9
Msa1166090	MtrunA17_Chr3g0140631	25.442	283	199	6	204	476	6	286	2.66e-14	73.6
Msa1166090	MtrunA17_Chr1g0190131	28.185	259	170	9	232	476	6	262	7.31e-14	72.0
Msa1166090	MtrunA17_Chr4g0059121	31.126	151	95	5	332	474	161	310	7.79e-14	72.8
Msa1166090	MtrunA17_Chr3g0132591	29.344	259	156	9	234	476	111	358	9.75e-14	73.2
Msa1166090	MtrunA17_Chr2g0310761	24.627	268	170	11	233	473	937	1199	1.00e-13	73.9
Msa1166090	MtrunA17_Chr8g0346081	27.106	273	176	12	230	485	11	277	1.07e-13	73.2
Msa1166090	MtrunA17_Chr2g0310781	23.881	268	170	11	234	473	844	1105	1.46e-13	73.6
Msa1166090	MtrunA17_Chr3g0133541	29.297	256	161	12	241	477	313	567	1.80e-13	72.8
Msa1166090	MtrunA17_Chr8g0357611	24.719	267	169	11	234	473	1369	1630	1.92e-13	73.2
Msa1166090	MtrunA17_Chr3g0102451	27.737	274	173	10	184	436	269	538	2.28e-13	72.4
Msa1166090	MtrunA17_Chr6g0453711	26.721	247	146	11	205	426	74	310	3.82e-13	71.6
Msa1166090	MtrunA17_Chr7g0218071	24.695	328	182	14	211	481	89	408	5.34e-13	71.6
Msa1166090	MtrunA17_Chr4g0061141	27.907	215	141	8	224	426	93	305	6.69e-13	71.2
Msa1166090	MtrunA17_Chr4g0066691	26.908	249	163	9	190	426	63	304	7.94e-13	70.9
Msa1166090	MtrunA17_Chr2g0286421	28.112	249	160	10	190	426	61	302	8.99e-13	70.5
Msa1166090	MtrunA17_Chr5g0441691	24.776	335	199	14	170	476	15	324	1.04e-12	70.1
Msa1166090	MtrunA17_Chr7g0267771	24.254	268	169	9	234	476	86	344	1.06e-12	70.1
Msa1166090	MtrunA17_Chr1g0211611	32.484	157	87	8	332	475	399	549	1.24e-12	70.1
Msa1166090	MtrunA17_Chr1g0196631	25.940	266	165	11	234	472	899	1159	1.57e-12	70.1
Msa1166090	MtrunA17_Chr3g0131861	28.169	213	138	8	226	426	88	297	1.68e-12	69.7
Msa1166090	MtrunA17_Chr8g0384001	26.481	287	162	14	220	476	16	283	1.68e-12	69.7
Msa1166090	MtrunA17_Chr6g0461841	25.746	268	165	11	234	473	966	1227	1.95e-12	70.1
Msa1166090	MtrunA17_Chr2g0305141	25.275	273	166	11	233	475	1081	1345	1.99e-12	70.1
Msa1166090	MtrunA17_Chr5g0396361	29.767	215	137	9	224	426	128	340	2.28e-12	69.3
Msa1166090	MtrunA17_Chr1g0205471	25.784	287	165	13	221	478	13	280	3.04e-12	68.9
Msa1166090	MtrunA17_Chr8g0355131	27.230	213	115	7	291	476	105	304	3.07e-12	68.9
Msa1166090	MtrunA17_Chr1g0197721	25.943	212	125	7	234	421	50	253	4.00e-12	68.2
Msa1166090	MtrunA17_Chr8g0385971	27.358	212	141	7	226	426	81	290	5.25e-12	68.2
Msa1166090	MtrunA17_Chr7g0276111	26.545	275	147	13	239	476	148	404	6.87e-12	67.8
Msa1166090	MtrunA17_Chr7g0273851	25.862	290	157	13	222	485	14	271	8.57e-12	67.8
Msa1166090	MtrunA17_Chr1g0176421	26.259	278	151	14	234	476	159	417	1.70e-11	66.6
Msa1166090	MtrunA17_Chr3g0129771	28.293	205	110	8	239	420	37	227	2.68e-11	65.9
Msa1166090	MtrunA17_Chr5g0432541	24.904	261	165	12	241	478	33	285	2.76e-11	65.9
Msa1166090	MtrunA17_Chr4g0000431	26.471	272	160	11	239	481	28	288	3.53e-11	65.9
Msa1166090	MtrunA17_Chr6g0455931	26.255	259	164	13	241	478	35	287	4.67e-11	65.1
Msa1166090	MtrunA17_Chr5g0397101	25.670	261	159	9	240	475	72	322	4.89e-11	65.1
Msa1166090	MtrunA17_Chr3g0141871	24.088	274	177	10	222	484	19	272	5.74e-11	64.3
Msa1166090	MtrunA17_Chr8g0383451	27.723	202	123	8	241	426	4	198	7.23e-11	64.3
Msa1166090	MtrunA17_Chr4g0074791	24.314	255	173	8	239	475	99	351	7.52e-11	64.3
Msa1166090	MtrunA17_Chr3g0107011	29.279	222	130	10	284	487	64	276	7.67e-11	64.3
Msa1166090	MtrunA17_Chr6g0450571	25.442	283	165	11	234	484	15	283	7.90e-11	64.7
Msa1166090	MtrunA17_Chr3g0099951	24.752	202	142	5	239	431	18	218	8.81e-11	63.9

Query id	Subject id	identity %	alignment length	mismatches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa1166090	AT1G02970.1	59.138	487	187	6	2	480	15	497	0.0	589
Msa1166090	AT4G19110.1	26.978	278	165	6	238	478	7	283	5.44e-23	102
Msa1166090	AT4G19110.2	26.978	278	165	6	238	478	7	283	5.61e-23	102
Msa1166090	AT5G45430.2	26.619	278	166	6	238	478	7	283	1.15e-20	95.1
Msa1166090	AT5G45430.1	26.619	278	166	6	238	478	7	283	1.23e-20	95.1
Msa1166090	AT3G20860.1	29.851	268	170	11	234	487	3	266	3.48e-20	93.2
Msa1166090	AT1G49580.1	30.961	281	148	12	239	487	154	420	8.58e-20	92.8
Msa1166090	AT3G19100.1	30.000	270	144	11	239	476	148	404	1.47e-19	92.4
Msa1166090	AT1G76040.2	29.434	265	156	11	234	476	113	368	1.93e-19	91.7
Msa1166090	AT1G76040.3	29.434	265	156	11	234	476	113	368	2.04e-19	91.3
Msa1166090	AT1G08650.1	29.278	263	167	7	239	484	19	279	1.41e-18	86.3
Msa1166090	AT3G12200.1	27.612	268	177	9	234	487	18	282	5.08e-18	87.4
Msa1166090	AT4G19110.3	28.000	225	125	5	291	478	3	227	1.19e-17	85.5
Msa1166090	AT3G63280.2	30.078	256	162	11	235	476	4	256	2.33e-17	85.1
Msa1166090	AT3G63280.3	30.078	256	162	11	235	476	4	256	2.33e-17	85.1
Msa1166090	AT3G63280.1	30.078	256	162	11	235	476	4	256	2.33e-17	85.1
Msa1166090	AT3G50530.1	29.371	286	150	13	227	476	139	408	2.54e-17	85.5
Msa1166090	AT3G63280.4	30.078	256	162	11	235	476	58	310	4.51e-17	84.7
Msa1166090	AT4G12020.3	27.675	271	162	11	225	482	1616	1865	8.78e-17	84.3
Msa1166090	AT4G12020.10	27.675	271	162	11	225	482	1608	1857	9.09e-17	84.3
Msa1166090	AT1G08650.2	29.200	250	158	7	239	471	19	266	1.68e-16	80.1
Msa1166090	AT4G13020.7	25.424	295	178	8	228	485	1	290	2.03e-16	81.3
Msa1166090	AT4G13020.4	25.424	295	178	8	228	485	1	290	2.28e-16	81.3
Msa1166090	AT4G13020.1	25.424	295	178	8	228	485	1	290	2.30e-16	81.6
Msa1166090	AT4G13020.6	25.424	295	178	8	228	485	1	290	2.33e-16	81.3
Msa1166090	AT4G08470.1	27.413	259	171	10	233	477	301	556	2.80e-16	82.0
Msa1166090	AT4G04700.1	26.996	263	161	10	239	476	32	288	3.18e-16	81.6
Msa1166090	AT4G13020.2	25.424	295	178	8	228	485	9	298	3.55e-16	81.3
Msa1166090	AT4G13020.3	25.424	295	178	8	228	485	9	298	3.57e-16	81.3
Msa1166090	AT1G18890.1	28.571	266	157	10	240	481	68	324	3.97e-16	81.3
Msa1166090	AT5G28290.1	28.405	257	169	9	235	478	4	258	4.13e-16	81.3
Msa1166090	AT5G28290.2	28.405	257	169	9	235	478	4	258	4.13e-16	81.3
Msa1166090	AT5G28290.3	28.405	257	169	9	235	478	4	258	4.65e-16	81.3
Msa1166090	AT1G69220.1	27.376	263	172	9	233	480	247	505	4.96e-16	81.6
Msa1166090	AT4G04710.2	25.391	256	168	7	239	476	40	290	5.79e-16	80.9
Msa1166090	AT3G12200.2	26.619	278	177	10	234	487	18	292	6.14e-16	80.9
Msa1166090	AT3G10540.1	25.095	263	162	9	234	469	44	298	6.70e-16	80.5
Msa1166090	AT4G04710.4	25.188	266	169	7	239	476	40	303	9.65e-16	80.1
Msa1166090	AT1G50240.3	30.040	253	164	10	234	476	5	254	1.03e-15	80.9
Msa1166090	AT1G50240.2	30.040	253	164	10	234	476	5	254	1.03e-15	80.9
Msa1166090	AT4G04710.1	25.188	266	169	7	239	476	40	303	1.05e-15	80.1
Msa1166090	AT1G54510.4	29.545	264	166	11	238	483	7	268	1.20e-15	80.1
Msa1166090	AT1G54510.2	29.545	264	166	11	238	483	7	268	1.20e-15	80.1
Msa1166090	AT1G54510.1	29.545	264	166	11	238	483	7	268	1.20e-15	80.1
Msa1166090	AT1G54510.3	29.545	264	166	11	238	483	7	268	1.20e-15	80.1
Msa1166090	AT4G21940.3	26.054	261	162	10	239	476	106	358	1.26e-15	79.7
Msa1166090	AT4G21940.2	26.054	261	162	10	239	476	106	358	1.55e-15	79.7
Msa1166090	AT3G21220.2	24.345	267	178	9	233	481	68	328	1.76e-15	78.2
Msa1166090	AT3G21220.1	24.345	267	178	9	233	481	68	328	1.76e-15	78.2
Msa1166090	AT4G29810.1	26.119	268	175	11	233	480	68	332	1.77e-15	78.2
Msa1166090	AT4G21940.1	26.054	261	162	10	239	476	106	358	1.88e-15	79.3
Msa1166090	AT4G29810.2	26.119	268	175	11	233	480	77	341	1.90e-15	78.2
Msa1166090	AT1G12680.1	28.679	265	156	11	241	484	113	365	2.30e-15	79.0
Msa1166090	AT5G12480.1	24.308	325	200	12	178	475	9	314	2.94e-15	78.6
Msa1166090	AT5G04510.2	24.715	263	163	9	234	469	43	297	3.29e-15	77.8
Msa1166090	AT5G04510.1	24.715	263	163	9	234	469	43	297	3.67e-15	78.2
Msa1166090	AT3G15220.1	26.236	263	181	7	235	486	15	275	5.94e-15	78.2
Msa1166090	AT5G66850.2	26.616	263	171	9	241	483	352	612	8.32e-15	77.4
Msa1166090	AT5G66850.1	26.616	263	171	9	241	483	352	612	9.39e-15	77.4
Msa1166090	AT1G12580.1	26.568	271	156	10	239	480	48	304	1.04e-14	77.0
Msa1166090	AT5G19450.2	26.415	265	164	9	240	481	62	318	1.26e-14	76.6
Msa1166090	AT5G19450.1	26.415	265	164	9	240	481	62	318	1.26e-14	76.6
Msa1166090	AT4G04695.1	25.843	267	159	10	239	476	32	288	1.55e-14	76.3
Msa1166090	AT4G13020.5	23.607	305	180	10	228	485	1	299	1.88e-14	75.9
Msa1166090	AT4G13020.8	23.607	305	180	10	228	485	1	299	2.47e-14	75.1
Msa1166090	AT2G45490.1	25.000	256	176	6	233	476	20	271	2.83e-14	73.9
Msa1166090	AT1G69220.2	27.626	257	167	9	239	480	226	478	3.58e-14	75.9
Msa1166090	AT1G30270.1	27.885	208	137	7	291	486	88	294	5.63e-14	74.3
Msa1166090	AT1G30270.2	27.885	208	137	7	291	486	88	294	5.73e-14	74.3
Msa1166090	AT3G49370.1	29.885	174	93	6	264	421	180	340	1.41e-13	73.6
Msa1166090	AT1G30270.3	30.588	170	107	6	327	486	29	197	1.53e-13	72.8
Msa1166090	AT2G25880.1	26.070	257	172	7	233	476	23	274	1.59e-13	71.6
Msa1166090	AT2G25880.4	26.070	257	172	7	233	476	36	287	1.61e-13	71.6
Msa1166090	AT3G57530.2	25.455	275	165	12	240	487	68	329	2.03e-13	72.4
Msa1166090	AT4G29810.3	26.054	261	170	11	233	473	77	334	2.55e-13	71.6
Msa1166090	AT1G01140.3	25.275	273	181	9	229	483	12	279	4.25e-13	71.6
Msa1166090	AT3G57530.1	25.455	275	165	12	240	487	68	329	4.37e-13	72.0
Msa1166090	AT1G01140.1	25.275	273	181	9	229	483	12	279	4.38e-13	71.6
Msa1166090	AT1G23700.2	28.889	270	164	13	234	484	15	275	4.43e-13	71.2
Msa1166090	AT5G50860.1	28.365	208	136	7	230	426	109	314	4.48e-13	72.0
Msa1166090	AT1G79570.2	25.180	278	173	13	225	473	953	1224	5.52e-13	72.0
Msa1166090	AT1G79570.1	25.180	278	173	13	225	473	953	1224	5.52e-13	72.0
Msa1166090	AT4G36070.1	28.000	200	116	6	241	421	77	267	5.75e-13	71.6
Msa1166090	AT5G50860.2	28.365	208	136	7	230	426	109	314	5.87e-13	71.2
Msa1166090	AT1G23700.3	28.889	270	164	13	234	484	15	275	6.41e-13	71.2
Msa1166090	AT1G23700.1	28.889	270	164	13	234	484	15	275	7.13e-13	70.9
Msa1166090	AT5G58350.1	27.586	261	162	14	239	478	23	277	7.18e-13	71.2
Msa1166090	AT4G36070.2	28.000	200	116	6	241	421	77	267	7.92e-13	71.2
Msa1166090	AT1G49160.2	28.155	206	111	8	239	421	32	223	9.63e-13	70.9
Msa1166090	AT1G54610.1	26.693	251	165	9	188	426	75	318	1.12e-12	70.9
Msa1166090	AT1G54610.3	26.693	251	165	9	188	426	75	318	1.12e-12	70.9
Msa1166090	AT1G54610.2	26.693	251	165	9	188	426	75	318	1.12e-12	70.9
Msa1166090	AT3G50730.1	25.856	263	170	9	232	472	33	292	1.36e-12	69.7
Msa1166090	AT2G38910.1	25.228	329	182	14	188	476	86	390	1.45e-12	70.5
Msa1166090	AT5G04510.3	25.943	212	125	7	234	421	43	246	1.69e-12	68.6
Msa1166090	AT4G04740.4	25.620	242	149	10	258	476	92	325	2.08e-12	69.7
Msa1166090	AT4G04740.6	25.620	242	149	10	258	476	92	325	2.08e-12	69.7
Msa1166090	AT4G04740.5	25.620	242	149	10	258	476	92	325	2.08e-12	69.7
Msa1166090	AT4G04740.3	25.620	242	149	10	258	476	92	325	2.08e-12	69.7
Msa1166090	AT4G04740.1	25.620	242	149	10	258	476	92	325	2.08e-12	69.7
Msa1166090	AT4G04740.7	25.620	242	149	10	258	476	92	325	2.08e-12	69.7
Msa1166090	AT3G23000.1	25.893	224	148	7	277	486	69	288	2.10e-12	69.3
Msa1166090	AT2G26980.1	26.540	211	138	6	284	480	64	271	2.45e-12	68.9
Msa1166090	AT1G16270.1	24.719	267	169	11	234	473	862	1123	2.49e-12	70.1
Msa1166090	AT1G16270.2	24.719	267	169	11	234	473	862	1123	2.49e-12	70.1
Msa1166090	AT1G16270.3	24.719	267	169	11	234	473	862	1123	2.49e-12	70.1
Msa1166090	AT2G26980.5	26.540	211	138	6	284	480	64	271	2.61e-12	68.9
Msa1166090	AT5G24360.1	28.044	271	140	11	257	478	480	744	2.79e-12	69.7
Msa1166090	AT5G24360.2	28.044	271	140	11	257	478	486	750	2.95e-12	69.7
Msa1166090	AT4G04740.2	25.620	242	149	10	258	476	92	325	3.03e-12	69.3
Msa1166090	AT5G24360.3	28.044	271	140	11	257	478	466	730	3.36e-12	69.7
Msa1166090	AT2G26980.3	26.540	211	138	6	284	480	64	271	4.03e-12	68.6
Msa1166090	AT2G26980.4	26.540	211	138	6	284	480	74	281	4.12e-12	68.6
Msa1166090	AT3G07980.1	27.068	266	170	11	239	485	24	284	4.28e-12	69.3
Msa1166090	AT3G07980.2	27.068	266	170	11	239	485	24	284	4.77e-12	69.3
Msa1166090	AT5G12180.1	26.692	266	154	12	239	476	77	329	5.57e-12	68.6
Msa1166090	AT2G35050.1	24.286	280	169	12	234	484	973	1238	5.99e-12	68.9
Msa1166090	AT2G35050.2	24.286	280	169	12	234	484	973	1238	5.99e-12	68.9
Msa1166090	AT1G59580.2	24.272	309	170	12	222	476	19	317	6.16e-12	67.8
Msa1166090	AT1G59580.1	24.272	309	170	12	222	476	19	317	6.16e-12	67.8
Msa1166090	AT4G26890.1	29.070	172	109	8	316	479	88	254	7.44e-12	67.8
Msa1166090	AT5G19360.1	25.191	262	163	10	239	476	72	324	1.01e-11	67.4
Msa1166090	AT3G10660.2	25.180	278	169	11	228	476	175	442	1.22e-11	67.4
Msa1166090	AT3G10660.1	25.180	278	169	11	228	476	175	442	1.22e-11	67.4
Msa1166090	AT4G10010.2	26.522	230	148	9	215	426	130	356	1.23e-11	67.4
Msa1166090	AT3G53930.2	24.345	267	180	8	230	478	15	277	1.51e-11	67.4
Msa1166090	AT3G12200.4	26.570	207	137	7	294	487	12	216	1.56e-11	67.0
Msa1166090	AT3G45640.1	28.251	223	139	9	221	426	20	238	1.59e-11	66.2
Msa1166090	AT1G04700.1	24.535	269	171	11	233	474	764	1027	1.62e-11	67.4
Msa1166090	AT1G04700.2	24.535	269	171	11	233	474	764	1027	1.62e-11	67.4
Msa1166090	AT3G53930.1	24.345	267	180	8	230	478	15	277	1.63e-11	67.4
Msa1166090	AT5G23580.1	24.809	262	160	10	241	476	28	278	1.65e-11	66.6
Msa1166090	AT3G22420.3	25.573	262	140	11	239	474	99	331	1.84e-11	67.0
Msa1166090	AT3G22420.4	25.573	262	140	11	239	474	99	331	1.94e-11	67.0
Msa1166090	AT3G22420.1	25.573	262	140	11	239	474	28	260	2.18e-11	66.6
Msa1166090	AT3G22420.5	25.573	262	140	11	239	474	28	260	2.46e-11	66.6
Msa1166090	AT2G35890.2	24.138	261	165	9	240	476	137	388	2.51e-11	66.2
Msa1166090	AT2G35890.1	24.138	261	165	9	240	476	137	388	2.51e-11	66.2
Msa1166090	AT1G71530.2	27.273	209	137	8	230	426	142	347	2.55e-11	66.2
Msa1166090	AT1G53570.5	25.097	259	153	10	241	485	220	451	2.55e-11	66.2
Msa1166090	AT1G71530.1	27.094	203	135	7	235	426	147	347	3.79e-11	65.9
Msa1166090	AT5G14720.1	25.000	276	169	10	234	481	15	280	3.92e-11	65.9
Msa1166090	AT5G14720.2	25.000	276	169	10	234	481	15	280	3.92e-11	65.9
Msa1166090	AT1G71530.4	26.606	218	145	8	230	435	142	356	4.23e-11	65.1
Msa1166090	AT5G39420.1	29.064	203	131	8	235	426	105	305	4.27e-11	65.9
Msa1166090	AT1G54960.1	27.692	260	161	10	241	477	74	329	4.37e-11	65.9
Msa1166090	AT1G54960.2	27.692	260	161	10	241	477	74	329	4.37e-11	65.9
Msa1166090	AT1G53050.2	27.092	251	147	11	215	448	108	339	4.42e-11	65.9
Msa1166090	AT1G53050.1	27.092	251	147	11	215	448	108	339	4.42e-11	65.9
Msa1166090	AT4G24100.1	24.911	281	171	10	227	478	25	294	4.44e-11	65.9
Msa1166090	AT4G30960.1	26.389	216	131	9	291	487	81	287	4.54e-11	65.1
Msa1166090	AT5G10930.1	25.581	258	160	9	241	476	18	265	4.55e-11	65.1
Msa1166090	AT4G24100.2	24.911	281	171	10	227	478	25	294	5.07e-11	65.5
Msa1166090	AT4G24100.4	24.911	281	171	10	227	478	41	310	5.21e-11	65.5
Msa1166090	AT4G24100.3	24.911	281	171	10	227	478	41	310	5.60e-11	65.5
Msa1166090	AT4G08470.2	31.333	150	95	5	233	376	301	448	5.73e-11	65.1
Msa1166090	AT1G71530.3	27.273	209	137	8	230	426	142	347	5.80e-11	65.1
Msa1166090	AT1G35670.1	24.345	267	177	9	230	476	21	282	6.48e-11	65.1
Msa1166090	AT3G59790.1	28.141	199	132	7	238	426	63	260	6.58e-11	64.7
Msa1166090	AT4G23650.1	27.203	261	157	11	240	476	83	334	6.71e-11	65.1
Msa1166090	AT1G48260.1	29.208	202	125	9	281	468	59	256	7.66e-11	64.7
Msa1166090	AT5G55090.1	26.012	173	117	7	316	480	89	258	9.72e-11	64.3
Msa1166090	AT1G74330.3	28.440	218	138	9	224	426	109	323	9.72e-11	64.7

Find 139 sgRNAs with CRISPR-Local

Find 339 sgRNAs with CRISPR-GE

CRISPR-Local

CRISPR-Local
sgRNA_sequence	on_target_score	Position	Region
TTCTTCCTTCCCCTTGATTT+TGG	0.064851	7_4:-58094992	None:intergenic
GTCTATAAGCTTGGTGATTT+TGG	0.139018	7_4:+58098408	Msa1166090:CDS
TTCAATTTCTCCGGGGATTT+AGG	0.142730	7_4:-58095512	None:intergenic
CCATCATAAGCTGTAAATTT+AGG	0.146319	7_4:-58097486	None:intergenic
CTTAAGGCCCTGTCGAAAAT+TGG	0.161314	7_4:-58099428	None:intergenic
AAACAACAGGCAAACATTTC+TGG	0.179440	7_4:-58099704	None:intergenic
CATAGGGATCTGTCTCCTTT+TGG	0.182775	7_4:-58097293	None:intergenic
CTTTAGTAACCCCTATTTAA+AGG	0.192157	7_4:+58097263	Msa1166090:CDS
TTGGGAAAGGTCCTTTAAAT+AGG	0.227358	7_4:-58097274	None:intergenic
TACCTGCACATTTGGATCTT+TGG	0.232933	7_4:-58097320	None:intergenic
CTGCAGCTACATTGCGTTGC+AGG	0.263739	7_4:+58097223	Msa1166090:CDS
CCAAAAGACATTCACAAAAT+TGG	0.268877	7_4:-58099546	None:intergenic
GGTGGTCATAATTCTCATTA+AGG	0.271396	7_4:-58098500	None:intergenic
TCAATTTCTCCGGGGATTTA+GGG	0.297218	7_4:-58095511	None:intergenic
TACTTCTCTTATCAGCAAAT+TGG	0.305098	7_4:+58097639	Msa1166090:intron
TTCAAAATCCGCTGATTATC+CGG	0.313101	7_4:-58095351	None:intergenic
CAAATCAAAATCCTTCCATT+AGG	0.314586	7_4:+58095146	Msa1166090:CDS
AATTCTCATTAAGGATTTCC+TGG	0.316106	7_4:-58098491	None:intergenic
ATGGACTTAAAATATATTAA+TGG	0.316976	7_4:+58099655	Msa1166090:three_prime_UTR
TGGGAAAGGTCCTTTAAATA+GGG	0.319625	7_4:-58097273	None:intergenic
TTCTTAGTCAAGATTTCTTC+TGG	0.320527	7_4:+58095209	Msa1166090:CDS
GAACGGTATCGATTTCAATA+AGG	0.332586	7_4:+58095371	Msa1166090:CDS
TTGTGGGCTATTATACTTCA+TGG	0.333207	7_4:+58097996	Msa1166090:CDS
CATCATAAGCTGTAAATTTA+GGG	0.350243	7_4:-58097485	None:intergenic
TAGAGTGATACCTGCACATT+TGG	0.356447	7_4:-58097328	None:intergenic
CACCATGCGCGAGAATTATC+AGG	0.356776	7_4:-58099583	None:intergenic
CAGAATGTGACACATAGTTC+TGG	0.366945	7_4:-58097203	None:intergenic
CAAGTTCCACAACTTGTTGA+TGG	0.375134	7_4:-58097116	None:intergenic
TCTCTGAATCGAGAAGGTTC+TGG	0.376382	7_4:-58095123	None:intergenic
AAATCAAAATCCTTCCATTA+GGG	0.376468	7_4:+58095147	Msa1166090:CDS
TTGAAGGAGAAAAGCTTTGA+TGG	0.378377	7_4:+58097829	Msa1166090:intron
AAAGTATTAAAGCGAATAGA+TGG	0.379092	7_4:+58097687	Msa1166090:CDS
TTAGTAGTATTCAATTTCTC+CGG	0.379490	7_4:-58095521	None:intergenic
GGTTCAAGCTCTGGCAGCAT+TGG	0.388551	7_4:+58097853	Msa1166090:CDS
CCTAAATTTACAGCTTATGA+TGG	0.388769	7_4:+58097486	Msa1166090:CDS
GTTCAAGCTCTGGCAGCATT+GGG	0.395220	7_4:+58097854	Msa1166090:CDS
GACACATAGTTCTGGGCCTT+CGG	0.398281	7_4:-58097195	None:intergenic
TTAAGGCCCTGTCGAAAATT+GGG	0.408531	7_4:-58099427	None:intergenic
AATAGTAGTAATAGTGTGTT+TGG	0.408847	7_4:-58094904	None:intergenic
TTATTCTTCATCTTCTTCAC+TGG	0.421992	7_4:+58094925	Msa1166090:five_prime_UTR
AAATCACCTATGCCAGAATC+AGG	0.426205	7_4:+58098576	Msa1166090:CDS
ATGTACAACAGACACCTAAC+TGG	0.427081	7_4:-58099628	None:intergenic
CTGGCAGAAGGCCTCTTAAC+CGG	0.429177	7_4:-58099389	None:intergenic
ATCAGCATCGGTAGCATCAT+TGG	0.430519	7_4:-58095173	None:intergenic
TTATCCGGAGTTATGTAATC+TGG	0.433913	7_4:-58095336	None:intergenic
TTTAAAGGACCTTTCCCAAA+AGG	0.437149	7_4:+58097278	Msa1166090:CDS
CATCAACAAGTTGTGGAACT+TGG	0.439973	7_4:+58097117	Msa1166090:CDS
GAAGGCCTCTTAACCGGATC+AGG	0.440181	7_4:-58099383	None:intergenic
AGCATCATTGGTAACCCTAA+TGG	0.442002	7_4:-58095161	None:intergenic
GTATTTGCAATGGTCCAGTT+AGG	0.445422	7_4:+58099614	Msa1166090:three_prime_UTR
TGTGTCTTTCTCTACCCAAC+TGG	0.450537	7_4:-58099735	None:intergenic
CGTGCATCTCCTTCCTCAAT+CGG	0.457649	7_4:-58098459	None:intergenic
GAAGAAGTTATAGTCGTTGT+TGG	0.463269	7_4:-58095094	None:intergenic
GTGTCTGTTGTACATTGTAA+TGG	0.464251	7_4:+58099636	Msa1166090:three_prime_UTR
TTTGATGGAGGTTCAAGCTC+TGG	0.468681	7_4:+58097844	Msa1166090:CDS
GGCAAGTTGCCACTCCTGCC+TGG	0.472331	7_4:+58098624	Msa1166090:CDS
TGATAGTAGCCTTCCGATTG+AGG	0.477068	7_4:+58098446	Msa1166090:CDS
AAAATCAAGGGGAAGGAAGA+AGG	0.477940	7_4:+58094994	Msa1166090:CDS
TTGGATCTTTGGTTTGCATA+GGG	0.480814	7_4:-58097309	None:intergenic
TAAAAGCAAAAGATGTCGAC+TGG	0.484851	7_4:+58095541	Msa1166090:CDS
GGCCATGATCGATCCTGATC+CGG	0.491918	7_4:+58099370	Msa1166090:intron
ATTCTCATTAAGGATTTCCT+GGG	0.493473	7_4:-58098490	None:intergenic
CACTGACTTTCATGAGATTG+AGG	0.501967	7_4:+58097524	Msa1166090:CDS
TTGTTGATGGTCACCAGAAA+AGG	0.502504	7_4:-58097103	None:intergenic
TCGATCCTGATCCGGTTAAG+AGG	0.503788	7_4:+58099378	Msa1166090:CDS
TTCTCCGGGGATTTAGGGCA+AGG	0.506459	7_4:-58095506	None:intergenic
TAGTAGTATTCAATTTCTCC+GGG	0.510401	7_4:-58095520	None:intergenic
AGAATGTGACACATAGTTCT+GGG	0.510819	7_4:-58097202	None:intergenic
TCTTATCAGCAAATTGGTCG+AGG	0.512410	7_4:+58097645	Msa1166090:intron
ACAAGTTGTGGAACTTGGTA+AGG	0.513324	7_4:+58097122	Msa1166090:CDS
CTAAATTTACAGCTTATGAT+GGG	0.515148	7_4:+58097487	Msa1166090:CDS
TGCAGCTACATTGCGTTGCA+GGG	0.517169	7_4:+58097224	Msa1166090:CDS
TGGGTTCTCTACCAACTCTC+TGG	0.519512	7_4:-58099408	None:intergenic
CCAGAAAAGGTAGGGCTAAG+AGG	0.520423	7_4:-58097090	None:intergenic
CAGAAAAGGTAGGGCTAAGA+GGG	0.522352	7_4:-58097089	None:intergenic
CTACATAGATAGACAGATGA+TGG	0.526702	7_4:-58099501	None:intergenic
GTTATAGTCGTTGTTGGTAA+CGG	0.526884	7_4:-58095088	None:intergenic
GGAAGTAGCTGTTGATATAA+CGG	0.528442	7_4:+58097158	Msa1166090:CDS
TGACATCCTGATTCTGGCAT+AGG	0.528630	7_4:-58098582	None:intergenic
TTTGGATCTTTGGTTTGCAT+AGG	0.529211	7_4:-58097310	None:intergenic
AACCAAAGATCCAAATGTGC+AGG	0.530641	7_4:+58097318	Msa1166090:CDS
GCAATTTCAAAACTTGCTCA+AGG	0.530918	7_4:+58098656	Msa1166090:CDS
AACCGGATCAGGATCGATCA+TGG	0.537059	7_4:-58099372	None:intergenic
CGAACAACTGTACATTCAGA+TGG	0.538277	7_4:+58098027	Msa1166090:CDS
GAGGCCTTCTGCCAGAGAGT+TGG	0.541203	7_4:+58099397	Msa1166090:CDS
GGTTACCATGAGAACATTGT+GGG	0.544802	7_4:+58097980	Msa1166090:intron
TGGTGACCATCAACAAGTTG+TGG	0.545627	7_4:+58097110	Msa1166090:CDS
GGGAAAGGTCCTTTAAATAG+GGG	0.547532	7_4:-58097272	None:intergenic
TAGACAGATGATGGTCCAGC+AGG	0.554155	7_4:-58099492	None:intergenic
ACCGATGCTGATTCAAGAGA+TGG	0.558070	7_4:+58095184	Msa1166090:CDS
GTTGATATAACGGTAGCTGC+TGG	0.559132	7_4:+58097168	Msa1166090:CDS
AAACCCCAAAATCAAGGGGA+AGG	0.559167	7_4:+58094987	Msa1166090:CDS
ACGCAGTACACAGTTACAGC+TGG	0.560665	7_4:+58097728	Msa1166090:CDS
AAATAGGGGTTACTAAAGCA+AGG	0.563788	7_4:-58097258	None:intergenic
TAGCCCTTGCCCTAAATCCC+CGG	0.565880	7_4:+58095502	Msa1166090:CDS
AATAGCCCACAATGTTCTCA+TGG	0.571060	7_4:-58097985	None:intergenic
AGAAAATATCAACCTTGTCA+AGG	0.580681	7_4:-58098521	None:intergenic
TGAAATTGCAATGAATGACC+AGG	0.582007	7_4:-58098642	None:intergenic
AGTAGCCTTCCGATTGAGGA+AGG	0.582590	7_4:+58098450	Msa1166090:CDS
AATGAATGACCAGGCAGGAG+TGG	0.584677	7_4:-58098633	None:intergenic
AGATGCACGTTATATGCCCC+AGG	0.587833	7_4:+58098473	Msa1166090:CDS
GATTTGTCTCTGAATCGAGA+AGG	0.588616	7_4:-58095129	None:intergenic
CTTATCAGCAAATTGGTCGA+GGG	0.596939	7_4:+58097646	Msa1166090:intron
AGGTTACCATGAGAACATTG+TGG	0.597160	7_4:+58097979	Msa1166090:intron
ACTTGTCATAGATGGTGTCT+CGG	0.597463	7_4:+58097062	Msa1166090:intron
GATGGTCACCAGAAAAGGTA+GGG	0.598031	7_4:-58097098	None:intergenic
TCTACCAACTCTCTGGCAGA+AGG	0.598894	7_4:-58099401	None:intergenic
TACTCCAGATTACATAACTC+CGG	0.599238	7_4:+58095332	Msa1166090:CDS
TGATGGTCACCAGAAAAGGT+AGG	0.601997	7_4:-58097099	None:intergenic
ATCGAGAAGGTTCTGGAAGG+CGG	0.606702	7_4:-58095116	None:intergenic
CACCTGATAATTCTCGCGCA+TGG	0.607613	7_4:+58099581	Msa1166090:three_prime_UTR
CATCTCCTTCCTCAATCGGA+AGG	0.611201	7_4:-58098455	None:intergenic
TCTCCGGGGATTTAGGGCAA+GGG	0.611486	7_4:-58095505	None:intergenic
GCCATCTCTTGAATCAGCAT+CGG	0.612326	7_4:-58095185	None:intergenic
GGGTTACTAAAGCAAGGAGG+AGG	0.617439	7_4:-58097252	None:intergenic
AAGGAGAAAAGCTTTGATGG+AGG	0.617943	7_4:+58097832	Msa1166090:intron
AGTTACAGCTGGATACAGAA+AGG	0.621788	7_4:+58097739	Msa1166090:CDS
TTGTCCTTCTGCTAATAACT+CGG	0.621799	7_4:-58098086	None:intergenic
CATAGCTTATCTGTAAACAA+AGG	0.622293	7_4:+58098061	Msa1166090:CDS
ATTGCAATGAATGACCAGGC+AGG	0.623023	7_4:-58098638	None:intergenic
AAATATCAACCTTGTCAAGG+TGG	0.623552	7_4:-58098518	None:intergenic
TGGTAAGGACTCTGTTGCAG+AGG	0.626891	7_4:+58097137	Msa1166090:CDS
GGCTCCGAGTTATTAGCAGA+AGG	0.627136	7_4:+58098082	Msa1166090:CDS
TGCAAGTTCTGTATTTGCAA+TGG	0.627920	7_4:+58099604	Msa1166090:three_prime_UTR
GGAAGGAAGAAGGCACCACT+CGG	0.629021	7_4:+58095004	Msa1166090:CDS
GAATTATGACCACCTTGACA+AGG	0.636957	7_4:+58098509	Msa1166090:CDS
TCATTGGTAACCCTAATGGA+AGG	0.639494	7_4:-58095157	None:intergenic
TTCTCATTAAGGATTTCCTG+GGG	0.641683	7_4:-58098489	None:intergenic
AAAAGCAAAAGATGTCGACT+GGG	0.647827	7_4:+58095542	Msa1166090:CDS
GTCTTTCTCTACCCAACTGG+AGG	0.652542	7_4:-58099732	None:intergenic
TGAATCGAGAAGGTTCTGGA+AGG	0.655355	7_4:-58095119	None:intergenic
GATCAGTGTCGATTGTGTCA+TGG	0.668665	7_4:+58099523	Msa1166090:three_prime_UTR
GGTAGCTGCTGGTAAGCCGA+AGG	0.673285	7_4:+58097179	Msa1166090:CDS
ACATAACTCCGGATAATCAG+CGG	0.676793	7_4:+58095343	Msa1166090:CDS
ACTGCGATTTATACACGACA+AGG	0.681658	7_4:+58098335	Msa1166090:CDS
CTTGTGTTACTCGCACCGAG+TGG	0.719837	7_4:-58095019	None:intergenic
CTGCGATTTATACACGACAA+GGG	0.720865	7_4:+58098336	Msa1166090:CDS
AGTAGTATTCAATTTCTCCG+GGG	0.726721	7_4:-58095519	None:intergenic
TAGGGGTTACTAAAGCAAGG+AGG	0.776403	7_4:-58097255	None:intergenic

CRISPR-GE

badsite warning	sgRNA_sequence	Strand	Position	Region	GC_content
!!	TGTATTTATAAATAGTAAAA+TGG	+	chr7_4:58095715-58095734	Msa1166090:intron	10.0%
!!!	ATTTATATTTTGTTTTGATT+TGG	+	chr7_4:58098289-58098308	Msa1166090:intron	10.0%
!!!	TTTTTTACATAAATATTATC+AGG	-	chr7_4:58098384-58098403	None:intergenic	10.0%
!!	GATAATATTTATGTAAAAAA+TGG	+	chr7_4:58098384-58098403	Msa1166090:CDS	10.0%
!!!	ATTTTTAAATCTTTGAATCT+TGG	-	chr7_4:58094959-58094978	None:intergenic	15.0%
!!	ATTTACTAATTTGAAAAACT+GGG	+	chr7_4:58095738-58095757	Msa1166090:intron	15.0%
!!	GAAAATTAACTTAAAAAACA+TGG	-	chr7_4:58096838-58096857	None:intergenic	15.0%
!!	ATGGACTTAAAATATATTAA+TGG	+	chr7_4:58099655-58099674	Msa1166090:three_prime_UTR	15.0%
!!	GATTTACTAATTTGAAAAAC+TGG	+	chr7_4:58095737-58095756	Msa1166090:intron	20.0%
!!!	AAGTTAATTTTCAACATATC+TGG	+	chr7_4:58096846-58096865	Msa1166090:intron	20.0%
!!!	ATAAAATTCCTTTTGAAACA+TGG	-	chr7_4:58097552-58097571	None:intergenic	20.0%
!!!	TTATGGTTTTCTCTTATTTA+AGG	+	chr7_4:58097885-58097904	Msa1166090:intron	20.0%
!!	AATTATGTAAAAAGTTATGC+AGG	-	chr7_4:58098259-58098278	None:intergenic	20.0%
!!!	TTTGTTTTGATTTGGAAATT+TGG	+	chr7_4:58098297-58098316	Msa1166090:intron	20.0%
!!!	CATTTTTTGAATCTTAAAGA+AGG	+	chr7_4:58098603-58098622	Msa1166090:CDS	20.0%
!!	TTAAAATATGTAAGCTACTA+TGG	+	chr7_4:58098871-58098890	Msa1166090:intron	20.0%
!!	TTAAAATATGTAAGCTACTA+TGG	+	chr7_4:58098871-58098890	Msa1166090:intron	20.0%
!!!	TGATGTTTTGATATTTATTC+AGG	+	chr7_4:58099349-58099368	Msa1166090:intron	20.0%
!	AAATCAAAATCCTTCCATTA+GGG	+	chr7_4:58095147-58095166	Msa1166090:CDS	25.0%
!	TCAATTTCGGAAAATGAAAA+GGG	-	chr7_4:58095251-58095270	None:intergenic	25.0%
!	TTAGTAGTATTCAATTTCTC+CGG	-	chr7_4:58095524-58095543	None:intergenic	25.0%
!!	AGACATTTTTCATGCAAATT+TGG	-	chr7_4:58095925-58095944	None:intergenic	25.0%
!	TGTCTACAAAGTCATAAATT+GGG	-	chr7_4:58096244-58096263	None:intergenic	25.0%
!	TTGTCTACAAAGTCATAAAT+TGG	-	chr7_4:58096245-58096264	None:intergenic	25.0%
!	TTTATGACTTTGTAGACAAT+TGG	+	chr7_4:58096246-58096265	Msa1166090:intron	25.0%
!	TTATGACTTTGTAGACAATT+GGG	+	chr7_4:58096247-58096266	Msa1166090:intron	25.0%
!!!	TAGAAAAGTTGGTAGAAAAT+AGG	+	chr7_4:58096505-58096524	Msa1166090:intron	25.0%
!!	TTTTCTAATGGTTTCTCTAA+TGG	-	chr7_4:58096640-58096659	None:intergenic	25.0%
!	AACCATTAGAAAAGATTTAG+AGG	+	chr7_4:58096647-58096666	Msa1166090:intron	25.0%
!	TGTACAAACAATTAAGCTAT+AGG	-	chr7_4:58096810-58096829	None:intergenic	25.0%
!	AACATATCTGGTTAAATTGT+AGG	+	chr7_4:58096858-58096877	Msa1166090:intron	25.0%
!	AATGGGTAAATAAATAGCAT+TGG	-	chr7_4:58097023-58097042	None:intergenic	25.0%
!	ACCATTATACAGTTAGAAAA+TGG	-	chr7_4:58097448-58097467	None:intergenic	25.0%
!	CATCATAAGCTGTAAATTTA+GGG	-	chr7_4:58097488-58097507	None:intergenic	25.0%
!	CTAAATTTACAGCTTATGAT+GGG	+	chr7_4:58097487-58097506	Msa1166090:CDS	25.0%
!!	AAAGTATTAAAGCGAATAGA+TGG	+	chr7_4:58097687-58097706	Msa1166090:CDS	25.0%
!	ACTGTTATGTAGATTTGATT+TGG	+	chr7_4:58098147-58098166	Msa1166090:intron	25.0%
!!!	AAGGTTGATATTTTCTCTTT+GGG	+	chr7_4:58098528-58098547	Msa1166090:CDS	25.0%
!	AATGAACTATGATTCTATTG+TGG	+	chr7_4:58098824-58098843	Msa1166090:intron	25.0%
!	AATGAACTATGATTCTATTG+TGG	+	chr7_4:58098824-58098843	Msa1166090:intron	25.0%
!	ATAAAACATGAGTTGTAAAC+AGG	-	chr7_4:58099169-58099188	None:intergenic	25.0%
	TTATTCTTCATCTTCTTCAC+TGG	+	chr7_4:58094925-58094944	Msa1166090:five_prime_UTR	30.0%
	CAAATCAAAATCCTTCCATT+AGG	+	chr7_4:58095146-58095165	Msa1166090:CDS	30.0%
	TTCTTAGTCAAGATTTCTTC+TGG	+	chr7_4:58095209-58095228	Msa1166090:CDS	30.0%
	CTCAATTTCGGAAAATGAAA+AGG	-	chr7_4:58095252-58095271	None:intergenic	30.0%
!	AAATGGAATCGACTCAATTT+CGG	-	chr7_4:58095264-58095283	None:intergenic	30.0%
!!!	ATTGAGTCGATTCCATTTTT+TGG	+	chr7_4:58095266-58095285	Msa1166090:intron	30.0%
	CAAACTTCGAAACCAAAAAA+TGG	-	chr7_4:58095281-58095300	None:intergenic	30.0%
	TAGTAGTATTCAATTTCTCC+GGG	-	chr7_4:58095523-58095542	None:intergenic	30.0%
	GATGACATACTTCTTGAATA+TGG	-	chr7_4:58096014-58096033	None:intergenic	30.0%
	AGAATAATCCGATGATTTCA+GGG	-	chr7_4:58096146-58096165	None:intergenic	30.0%
	TAGAATAATCCGATGATTTC+AGG	-	chr7_4:58096147-58096166	None:intergenic	30.0%
	GGACTAAACATATGTTCTAT+CGG	+	chr7_4:58096307-58096326	Msa1166090:intron	30.0%
!	TCTACCAACTTTTCTACTAT+AGG	-	chr7_4:58096501-58096520	None:intergenic	30.0%
!	GTTTCTCTAATGGTTTTCTT+AGG	-	chr7_4:58096630-58096649	None:intergenic	30.0%
!	GACCTCTAAATCTTTTCTAA+TGG	-	chr7_4:58096652-58096671	None:intergenic	30.0%
	GTTCTATCAAAGACCATATT+TGG	-	chr7_4:58096687-58096706	None:intergenic	30.0%
	TGGTCTTTGATAGAACATTA+TGG	+	chr7_4:58096691-58096710	Msa1166090:intron	30.0%
	ACTAAACATATCTAACTGGA+GGG	+	chr7_4:58096779-58096798	Msa1166090:intron	30.0%
	TTATACATTCCATGCTACAT+AGG	+	chr7_4:58096940-58096959	Msa1166090:intron	30.0%
!	GCATGTTGATTAGAGAAAAT+GGG	-	chr7_4:58097040-58097059	None:intergenic	30.0%
!	TGCATGTTGATTAGAGAAAA+TGG	-	chr7_4:58097041-58097060	None:intergenic	30.0%
	CTTTAGTAACCCCTATTTAA+AGG	+	chr7_4:58097263-58097282	Msa1166090:CDS	30.0%
!	ACTTTTCCACCATTAATGAA+CGG	-	chr7_4:58097374-58097393	None:intergenic	30.0%
!!	GCCATTTTCTAACTGTATAA+TGG	+	chr7_4:58097444-58097463	Msa1166090:intron	30.0%
	CCATCATAAGCTGTAAATTT+AGG	-	chr7_4:58097489-58097508	None:intergenic	30.0%
	CCTAAATTTACAGCTTATGA+TGG	+	chr7_4:58097486-58097505	Msa1166090:CDS	30.0%
!!	TGTTGAGAACTGTTTTGAAT+TGG	+	chr7_4:58097573-58097592	Msa1166090:intron	30.0%
	TACTTCTCTTATCAGCAAAT+TGG	+	chr7_4:58097639-58097658	Msa1166090:intron	30.0%
!	AAGGTATCATCTTCATACTA+CGG	+	chr7_4:58097758-58097777	Msa1166090:intron	30.0%
!!	AGCATTGGGTTTGTATTTTA+TGG	+	chr7_4:58097868-58097887	Msa1166090:intron	30.0%
!!	ATTTAAGGTTCAAGCATTGA+TGG	+	chr7_4:58097900-58097919	Msa1166090:intron	30.0%
	GTTTATCATCTTACCTCTAT+AGG	+	chr7_4:58097959-58097978	Msa1166090:intron	30.0%
	CATAGCTTATCTGTAAACAA+AGG	+	chr7_4:58098061-58098080	Msa1166090:CDS	30.0%
	ACTATAGATTAAGGAAACCA+TGG	-	chr7_4:58098233-58098252	None:intergenic	30.0%
	TGCAGGTTTACTATAGATTA+AGG	-	chr7_4:58098242-58098261	None:intergenic	30.0%
!!	TTTGATTTGGAAATTTGGAC+AGG	+	chr7_4:58098302-58098321	Msa1166090:intron	30.0%
	AAAAATGGTGTCTATAAGCT+TGG	+	chr7_4:58098399-58098418	Msa1166090:CDS	30.0%
	ATTCTCATTAAGGATTTCCT+GGG	-	chr7_4:58098493-58098512	None:intergenic	30.0%
	AATTCTCATTAAGGATTTCC+TGG	-	chr7_4:58098494-58098513	None:intergenic	30.0%
	AGAAAATATCAACCTTGTCA+AGG	-	chr7_4:58098524-58098543	None:intergenic	30.0%
!!!	CAAGGTTGATATTTTCTCTT+TGG	+	chr7_4:58098527-58098546	Msa1166090:CDS	30.0%
	AAAAAATGACATCCTGATTC+TGG	-	chr7_4:58098591-58098610	None:intergenic	30.0%
!	TCAATTTTTCGCTGTTCTTA+AGG	-	chr7_4:58099447-58099466	None:intergenic	30.0%
	CCAAAAGACATTCACAAAAT+TGG	-	chr7_4:58099549-58099568	None:intergenic	30.0%
!	CCAATTTTGTGAATGTCTTT+TGG	+	chr7_4:58099546-58099565	Msa1166090:three_prime_UTR	30.0%
	GAGAAAAACCCCAAAATCAA+GGG	+	chr7_4:58094982-58095001	Msa1166090:CDS	35.0%
	AGAAAAACCCCAAAATCAAG+GGG	+	chr7_4:58094983-58095002	Msa1166090:CDS	35.0%
!	GTTATAGTCGTTGTTGGTAA+CGG	-	chr7_4:58095091-58095110	None:intergenic	35.0%
	GAAGAAGTTATAGTCGTTGT+TGG	-	chr7_4:58095097-58095116	None:intergenic	35.0%
	TACTCCAGATTACATAACTC+CGG	+	chr7_4:58095332-58095351	Msa1166090:CDS	35.0%
	TTATCCGGAGTTATGTAATC+TGG	-	chr7_4:58095339-58095358	None:intergenic	35.0%
!	TTCAAAATCCGCTGATTATC+CGG	-	chr7_4:58095354-58095373	None:intergenic	35.0%
!!	GATAATCAGCGGATTTTGAA+CGG	+	chr7_4:58095354-58095373	Msa1166090:CDS	35.0%
!!	GAACGGTATCGATTTCAATA+AGG	+	chr7_4:58095371-58095390	Msa1166090:CDS	35.0%
!!	GGTATCGATTTCAATAAGGT+GGG	+	chr7_4:58095375-58095394	Msa1166090:intron	35.0%
!!	GTATCGATTTCAATAAGGTG+GGG	+	chr7_4:58095376-58095395	Msa1166090:intron	35.0%
	AGTAGTATTCAATTTCTCCG+GGG	-	chr7_4:58095522-58095541	None:intergenic	35.0%
	TAAAAGCAAAAGATGTCGAC+TGG	+	chr7_4:58095541-58095560	Msa1166090:CDS	35.0%
!	AAAAGCAAAAGATGTCGACT+GGG	+	chr7_4:58095542-58095561	Msa1166090:CDS	35.0%
	TACATGTGCATACACAAACA+CGG	-	chr7_4:58095699-58095718	None:intergenic	35.0%
	GGATGTCTCATCAAGTTTAT+GGG	+	chr7_4:58095759-58095778	Msa1166090:intron	35.0%
	GGATTGTGAACATATGTTGA+TGG	+	chr7_4:58095859-58095878	Msa1166090:intron	35.0%
	GCATGAAAAATGTCTACTCA+TGG	+	chr7_4:58095930-58095949	Msa1166090:intron	35.0%
	AGTATGTCATCTATGAAGCA+CGG	+	chr7_4:58096023-58096042	Msa1166090:intron	35.0%
	CATGTCGTATCCAATACTTA+TGG	-	chr7_4:58096052-58096071	None:intergenic	35.0%
	GAAGCACAGATACTCAAAAA+TGG	-	chr7_4:58096105-58096124	None:intergenic	35.0%
	AATAATCCGATGATTTCAGG+GGG	-	chr7_4:58096144-58096163	None:intergenic	35.0%
	GAATAATCCGATGATTTCAG+GGG	-	chr7_4:58096145-58096164	None:intergenic	35.0%
	TATCCCCATTATGCACAATT+GGG	-	chr7_4:58096184-58096203	None:intergenic	35.0%
	ATATCCCCATTATGCACAAT+TGG	-	chr7_4:58096185-58096204	None:intergenic	35.0%
	ACGTTGAAACTAGAAATGAC+AGG	-	chr7_4:58096215-58096234	None:intergenic	35.0%
	CAGACACCTTTCATAAAAAG+GGG	-	chr7_4:58096288-58096307	None:intergenic	35.0%
	CCAGACACCTTTCATAAAAA+GGG	-	chr7_4:58096289-58096308	None:intergenic	35.0%
	TCCAGACACCTTTCATAAAA+AGG	-	chr7_4:58096290-58096309	None:intergenic	35.0%
	AGACTAGACATGATAGGATT+AGG	+	chr7_4:58096442-58096461	Msa1166090:intron	35.0%
	AGCACCTATAGTAGAAAAGT+TGG	+	chr7_4:58096494-58096513	Msa1166090:intron	35.0%
	TGGTAGAAAATAGGCTTAGA+TGG	+	chr7_4:58096514-58096533	Msa1166090:intron	35.0%
	GAAAATAGGCTTAGATGGTT+TGG	+	chr7_4:58096519-58096538	Msa1166090:intron	35.0%
	TTGATCTACTCTTCTTACCA+CGG	-	chr7_4:58096571-58096590	None:intergenic	35.0%
	GGTAAGAAGAGTAGATCAAA+TGG	+	chr7_4:58096572-58096591	Msa1166090:intron	35.0%
	AAGAAGAGTAGATCAAATGG+AGG	+	chr7_4:58096575-58096594	Msa1166090:intron	35.0%
	AGTCAAGTTAAAAGAGGTAG+AGG	+	chr7_4:58096600-58096619	Msa1166090:intron	35.0%
	AGATTTAGAGGTCAATGAGT+TGG	+	chr7_4:58096659-58096678	Msa1166090:intron	35.0%
!	CAATGAGTTGGATCCAAATA+TGG	+	chr7_4:58096671-58096690	Msa1166090:intron	35.0%
	CTGGACTAAACATATCTAAC+TGG	+	chr7_4:58096775-58096794	Msa1166090:intron	35.0%
	GACTAAACATATCTAACTGG+AGG	+	chr7_4:58096778-58096797	Msa1166090:intron	35.0%
!	CACTAATTTTTCCATGTGGT+GGG	-	chr7_4:58096975-58096994	None:intergenic	35.0%
	ACATGCATACTTGTCATAGA+TGG	+	chr7_4:58097054-58097073	Msa1166090:intron	35.0%
	GGAAGTAGCTGTTGATATAA+CGG	+	chr7_4:58097158-58097177	Msa1166090:CDS	35.0%
	AGAATGTGACACATAGTTCT+GGG	-	chr7_4:58097205-58097224	None:intergenic	35.0%
	AAATAGGGGTTACTAAAGCA+AGG	-	chr7_4:58097261-58097280	None:intergenic	35.0%
	TGGGAAAGGTCCTTTAAATA+GGG	-	chr7_4:58097276-58097295	None:intergenic	35.0%
	TTGGGAAAGGTCCTTTAAAT+AGG	-	chr7_4:58097277-58097296	None:intergenic	35.0%
	TTTAAAGGACCTTTCCCAAA+AGG	+	chr7_4:58097278-58097297	Msa1166090:CDS	35.0%
!!	TTGGATCTTTGGTTTGCATA+GGG	-	chr7_4:58097312-58097331	None:intergenic	35.0%
!!	TTTGGATCTTTGGTTTGCAT+AGG	-	chr7_4:58097313-58097332	None:intergenic	35.0%
	AATGAACGGGATACTTGTAA+AGG	-	chr7_4:58097360-58097379	None:intergenic	35.0%
	ACAAGTATCCCGTTCATTAA+TGG	+	chr7_4:58097362-58097381	Msa1166090:intron	35.0%
!	CTTTTCCACCATTAATGAAC+GGG	-	chr7_4:58097373-58097392	None:intergenic	35.0%
	CTGTATAATGGTATGACTGT+AGG	+	chr7_4:58097456-58097475	Msa1166090:intron	35.0%
!	TTGAGGTACCATGTTTCAAA+AGG	+	chr7_4:58097541-58097560	Msa1166090:intron	35.0%
	CTCCTTCAATCACAGAATAT+CGG	-	chr7_4:58097818-58097837	None:intergenic	35.0%
!	TTGAAGGAGAAAAGCTTTGA+TGG	+	chr7_4:58097829-58097848	Msa1166090:intron	35.0%
!	TTGTGGGCTATTATACTTCA+TGG	+	chr7_4:58097996-58098015	Msa1166090:CDS	35.0%
	TTGTCCTTCTGCTAATAACT+CGG	-	chr7_4:58098089-58098108	None:intergenic	35.0%
	ATCTACATAACAGTCAGACA+AGG	-	chr7_4:58098141-58098160	None:intergenic	35.0%
!!	GTCTATAAGCTTGGTGATTT+TGG	+	chr7_4:58098408-58098427	Msa1166090:CDS	35.0%
	TTCTCATTAAGGATTTCCTG+GGG	-	chr7_4:58098492-58098511	None:intergenic	35.0%
	GGTGGTCATAATTCTCATTA+AGG	-	chr7_4:58098503-58098522	None:intergenic	35.0%
	AAATATCAACCTTGTCAAGG+TGG	-	chr7_4:58098521-58098540	None:intergenic	35.0%
!	ATTCTGGCATAGGTGATTTT+CGG	-	chr7_4:58098575-58098594	None:intergenic	35.0%
	TGAAATTGCAATGAATGACC+AGG	-	chr7_4:58098645-58098664	None:intergenic	35.0%
!	GCAATTTCAAAACTTGCTCA+AGG	+	chr7_4:58098656-58098675	Msa1166090:CDS	35.0%
	CGACTAATAAATCCAATGTG+TGG	+	chr7_4:58098752-58098771	Msa1166090:intron	35.0%
!!!	TTTTGAGATGTAGTACAGCA+TGG	-	chr7_4:58099013-58099032	None:intergenic	35.0%
	TAAACAGGTATAGCAATCCA+TGG	-	chr7_4:58099154-58099173	None:intergenic	35.0%
	AAAGTGAAAAACAAGTGTGG+TGG	-	chr7_4:58099471-58099490	None:intergenic	35.0%
	GGAAAAGTGAAAAACAAGTG+TGG	-	chr7_4:58099474-58099493	None:intergenic	35.0%
!!	TTGTTTTTCACTTTTCCTGC+TGG	+	chr7_4:58099477-58099496	Msa1166090:three_prime_UTR	35.0%
	CTACATAGATAGACAGATGA+TGG	-	chr7_4:58099504-58099523	None:intergenic	35.0%
	TGCAAGTTCTGTATTTGCAA+TGG	+	chr7_4:58099604-58099623	Msa1166090:three_prime_UTR	35.0%
	GTGTCTGTTGTACATTGTAA+TGG	+	chr7_4:58099636-58099655	Msa1166090:three_prime_UTR	35.0%
	AAACAACAGGCAAACATTTC+TGG	-	chr7_4:58099707-58099726	None:intergenic	35.0%
!!!	TTGTTTTTTCACCTCCAGTT+GGG	+	chr7_4:58099721-58099740	Msa1166090:three_prime_UTR	35.0%
	CGAGAAAAACCCCAAAATCA+AGG	+	chr7_4:58094981-58095000	Msa1166090:CDS	40.0%
!	TCTTCCTTCCCCTTGATTTT+GGG	-	chr7_4:58094994-58095013	None:intergenic	40.0%
!	TTCTTCCTTCCCCTTGATTT+TGG	-	chr7_4:58094995-58095014	None:intergenic	40.0%
	AAAATCAAGGGGAAGGAAGA+AGG	+	chr7_4:58094994-58095013	Msa1166090:CDS	40.0%
	GATTTGTCTCTGAATCGAGA+AGG	-	chr7_4:58095132-58095151	None:intergenic	40.0%
!	TCATTGGTAACCCTAATGGA+AGG	-	chr7_4:58095160-58095179	None:intergenic	40.0%
!	AGCATCATTGGTAACCCTAA+TGG	-	chr7_4:58095164-58095183	None:intergenic	40.0%
	ACATAACTCCGGATAATCAG+CGG	+	chr7_4:58095343-58095362	Msa1166090:CDS	40.0%
!!	CGGTATCGATTTCAATAAGG+TGG	+	chr7_4:58095374-58095393	Msa1166090:intron	40.0%
	TGTAATGTAATGTGTTCCGC+AGG	+	chr7_4:58095475-58095494	Msa1166090:intron	40.0%
	TCAATTTCTCCGGGGATTTA+GGG	-	chr7_4:58095514-58095533	None:intergenic	40.0%
	TTCAATTTCTCCGGGGATTT+AGG	-	chr7_4:58095515-58095534	None:intergenic	40.0%
	GGGATGTCTCATCAAGTTTA+TGG	+	chr7_4:58095758-58095777	Msa1166090:intron	40.0%
	CGACATGTATGAGTGCATAT+CGG	+	chr7_4:58096065-58096084	Msa1166090:intron	40.0%
	GACATGTATGAGTGCATATC+GGG	+	chr7_4:58096066-58096085	Msa1166090:intron	40.0%
	ACTCAAAAATGGCTTCTGAG+TGG	-	chr7_4:58096094-58096113	None:intergenic	40.0%
	ACCTCCCAATTGTGCATAAT+GGG	+	chr7_4:58096177-58096196	Msa1166090:intron	40.0%
!	CTCTAGCCCCTTTTTATGAA+AGG	+	chr7_4:58096279-58096298	Msa1166090:intron	40.0%
!!!	CCCTTTTTATGAAAGGTGTC+TGG	+	chr7_4:58096286-58096305	Msa1166090:intron	40.0%
	GTGGTAAGACTAGACATGAT+AGG	+	chr7_4:58096436-58096455	Msa1166090:intron	40.0%
	TGACATCATTAGAGAGAGAG+TGG	+	chr7_4:58096467-58096486	Msa1166090:intron	40.0%
	GACATCATTAGAGAGAGAGT+GGG	+	chr7_4:58096468-58096487	Msa1166090:intron	40.0%
	ACATCATTAGAGAGAGAGTG+GGG	+	chr7_4:58096469-58096488	Msa1166090:intron	40.0%
	GAGGAGAGTCAAGTTAAAAG+AGG	+	chr7_4:58096594-58096613	Msa1166090:intron	40.0%
!!	TTTTCCATGTGGTGGGAAAT+GGG	-	chr7_4:58096968-58096987	None:intergenic	40.0%
!!	TTTTTCCATGTGGTGGGAAA+TGG	-	chr7_4:58096969-58096988	None:intergenic	40.0%
!	GCACTAATTTTTCCATGTGG+TGG	-	chr7_4:58096976-58096995	None:intergenic	40.0%
!	GCAGCACTAATTTTTCCATG+TGG	-	chr7_4:58096979-58096998	None:intergenic	40.0%
	ACTTGTCATAGATGGTGTCT+CGG	+	chr7_4:58097062-58097081	Msa1166090:intron	40.0%
!!	TTGTTGATGGTCACCAGAAA+AGG	-	chr7_4:58097106-58097125	None:intergenic	40.0%
!!	CAAGTTCCACAACTTGTTGA+TGG	-	chr7_4:58097119-58097138	None:intergenic	40.0%
	CATCAACAAGTTGTGGAACT+TGG	+	chr7_4:58097117-58097136	Msa1166090:CDS	40.0%
	ACAAGTTGTGGAACTTGGTA+AGG	+	chr7_4:58097122-58097141	Msa1166090:CDS	40.0%
	CAGAATGTGACACATAGTTC+TGG	-	chr7_4:58097206-58097225	None:intergenic	40.0%
	GGGAAAGGTCCTTTAAATAG+GGG	-	chr7_4:58097275-58097294	None:intergenic	40.0%
!	ATAGGGATCTGTCTCCTTTT+GGG	-	chr7_4:58097295-58097314	None:intergenic	40.0%
	AACCAAAGATCCAAATGTGC+AGG	+	chr7_4:58097318-58097337	Msa1166090:CDS	40.0%
	TACCTGCACATTTGGATCTT+TGG	-	chr7_4:58097323-58097342	None:intergenic	40.0%
	TAGAGTGATACCTGCACATT+TGG	-	chr7_4:58097331-58097350	None:intergenic	40.0%
	AGTATCCCGTTCATTAATGG+TGG	+	chr7_4:58097365-58097384	Msa1166090:intron	40.0%
	GGTGGAAAAGTCATTGTAAC+TGG	+	chr7_4:58097383-58097402	Msa1166090:intron	40.0%
!!	CACTGACTTTCATGAGATTG+AGG	+	chr7_4:58097524-58097543	Msa1166090:CDS	40.0%
	CATGAAGTTGAATGCGATGA+AGG	-	chr7_4:58097604-58097623	None:intergenic	40.0%
	CTTCATCGCATTCAACTTCA+TGG	+	chr7_4:58097602-58097621	Msa1166090:intron	40.0%
	TCTTATCAGCAAATTGGTCG+AGG	+	chr7_4:58097645-58097664	Msa1166090:intron	40.0%
	CTTATCAGCAAATTGGTCGA+GGG	+	chr7_4:58097646-58097665	Msa1166090:intron	40.0%
	AGTTACAGCTGGATACAGAA+AGG	+	chr7_4:58097739-58097758	Msa1166090:CDS	40.0%
!	ACGGAGACTTCTTCTTTTCT+TGG	+	chr7_4:58097777-58097796	Msa1166090:intron	40.0%
!	CGGAGACTTCTTCTTTTCTT+GGG	+	chr7_4:58097778-58097797	Msa1166090:intron	40.0%
!!	TCACAGAATATCGGTGTTAG+TGG	-	chr7_4:58097809-58097828	None:intergenic	40.0%
	CACCGATATTCTGTGATTGA+AGG	+	chr7_4:58097813-58097832	Msa1166090:intron	40.0%
!	AAGGAGAAAAGCTTTGATGG+AGG	+	chr7_4:58097832-58097851	Msa1166090:intron	40.0%
	GTTCTCATGGTAACCTATAG+AGG	-	chr7_4:58097975-58097994	None:intergenic	40.0%
	AGGTTACCATGAGAACATTG+TGG	+	chr7_4:58097979-58097998	Msa1166090:intron	40.0%
	GGTTACCATGAGAACATTGT+GGG	+	chr7_4:58097980-58097999	Msa1166090:intron	40.0%
	AATAGCCCACAATGTTCTCA+TGG	-	chr7_4:58097988-58098007	None:intergenic	40.0%
	CGAACAACTGTACATTCAGA+TGG	+	chr7_4:58098027-58098046	Msa1166090:CDS	40.0%
	ACTGCGATTTATACACGACA+AGG	+	chr7_4:58098335-58098354	Msa1166090:CDS	40.0%
	CTGCGATTTATACACGACAA+GGG	+	chr7_4:58098336-58098355	Msa1166090:CDS	40.0%
	GAATTATGACCACCTTGACA+AGG	+	chr7_4:58098509-58098528	Msa1166090:CDS	40.0%
	AAATCACCTATGCCAGAATC+AGG	+	chr7_4:58098576-58098595	Msa1166090:CDS	40.0%
	CAAGTCTACAAACCACACAT+TGG	-	chr7_4:58098767-58098786	None:intergenic	40.0%
!	TGTGTGGTTTGTAGACTTGT+AGG	+	chr7_4:58098768-58098787	Msa1166090:intron	40.0%
!!!	CAGAATTTTCTGAAGCACCA+TGG	+	chr7_4:58099134-58099153	Msa1166090:intron	40.0%
!	GAACGATGCTACTTACTACT+TGG	-	chr7_4:58099247-58099266	None:intergenic	40.0%
!	TAGAGAACCCAATTTTCGAC+AGG	+	chr7_4:58099420-58099439	Msa1166090:CDS	40.0%
!	AGAGAACCCAATTTTCGACA+GGG	+	chr7_4:58099421-58099440	Msa1166090:CDS	40.0%
	TTAAGGCCCTGTCGAAAATT+GGG	-	chr7_4:58099430-58099449	None:intergenic	40.0%
	GTATTTGCAATGGTCCAGTT+AGG	+	chr7_4:58099614-58099633	Msa1166090:three_prime_UTR	40.0%
	ATGTACAACAGACACCTAAC+TGG	-	chr7_4:58099631-58099650	None:intergenic	40.0%
	ACTGGAGGTGAAAAAACAAC+AGG	-	chr7_4:58099720-58099739	None:intergenic	40.0%
!!!	GTTGTTTTTTCACCTCCAGT+TGG	+	chr7_4:58099720-58099739	Msa1166090:three_prime_UTR	40.0%
	AAACCCCAAAATCAAGGGGA+AGG	+	chr7_4:58094987-58095006	Msa1166090:CDS	45.0%
!	CTTCCTTCCCCTTGATTTTG+GGG	-	chr7_4:58094993-58095012	None:intergenic	45.0%
!!	TGAATCGAGAAGGTTCTGGA+AGG	-	chr7_4:58095122-58095141	None:intergenic	45.0%
	TCTCTGAATCGAGAAGGTTC+TGG	-	chr7_4:58095126-58095145	None:intergenic	45.0%
!!	ATCAGCATCGGTAGCATCAT+TGG	-	chr7_4:58095176-58095195	None:intergenic	45.0%
!!	ACCGATGCTGATTCAAGAGA+TGG	+	chr7_4:58095184-58095203	Msa1166090:CDS	45.0%
	GCCATCTCTTGAATCAGCAT+CGG	-	chr7_4:58095188-58095207	None:intergenic	45.0%
	GCATGTAGTGCGAATCAGTA+TGG	+	chr7_4:58095838-58095857	Msa1166090:intron	45.0%
	GCAGTCTCTTCTAAGTGGTA+GGG	-	chr7_4:58095963-58095982	None:intergenic	45.0%
	TGCAGTCTCTTCTAAGTGGT+AGG	-	chr7_4:58095964-58095983	None:intergenic	45.0%
	TACCACTTAGAAGAGACTGC+AGG	+	chr7_4:58095963-58095982	Msa1166090:intron	45.0%
	ACCACTTAGAAGAGACTGCA+GGG	+	chr7_4:58095964-58095983	Msa1166090:intron	45.0%
	AGCACGGACACCATAAGTAT+TGG	+	chr7_4:58096039-58096058	Msa1166090:intron	45.0%
	ATCACTCCCCCTGAAATCAT+CGG	+	chr7_4:58096135-58096154	Msa1166090:intron	45.0%
	GACCTCCCAATTGTGCATAA+TGG	+	chr7_4:58096176-58096195	Msa1166090:intron	45.0%
	CCTCCCAATTGTGCATAATG+GGG	+	chr7_4:58096178-58096197	Msa1166090:intron	45.0%
	ACCGGCAATGTTGTATGGTA+CGG	+	chr7_4:58096341-58096360	Msa1166090:intron	45.0%
	TCCGTACCATACAACATTGC+CGG	-	chr7_4:58096345-58096364	None:intergenic	45.0%
	TGTTGTATGGTACGGAGTGT+TGG	+	chr7_4:58096349-58096368	Msa1166090:intron	45.0%
!	GTTGTATGGTACGGAGTGTT+GGG	+	chr7_4:58096350-58096369	Msa1166090:intron	45.0%
	CGCTTACTTTACTCTCGTGT+TGG	-	chr7_4:58096386-58096405	None:intergenic	45.0%
	CGAGAGTAAAGTAAGCGTAG+CGG	+	chr7_4:58096389-58096408	Msa1166090:intron	45.0%
	CATCATTAGAGAGAGAGTGG+GGG	+	chr7_4:58096470-58096489	Msa1166090:intron	45.0%
	AAATGGGAGCCTATGTAGCA+TGG	-	chr7_4:58096952-58096971	None:intergenic	45.0%
	CAGAAAAGGTAGGGCTAAGA+GGG	-	chr7_4:58097092-58097111	None:intergenic	45.0%
	GATGGTCACCAGAAAAGGTA+GGG	-	chr7_4:58097101-58097120	None:intergenic	45.0%
	TGATGGTCACCAGAAAAGGT+AGG	-	chr7_4:58097102-58097121	None:intergenic	45.0%
	TGGTGACCATCAACAAGTTG+TGG	+	chr7_4:58097110-58097129	Msa1166090:CDS	45.0%
	GTTGATATAACGGTAGCTGC+TGG	+	chr7_4:58097168-58097187	Msa1166090:CDS	45.0%
	TAGGGGTTACTAAAGCAAGG+AGG	-	chr7_4:58097258-58097277	None:intergenic	45.0%
!!	GATCTGTCTCCTTTTGGGAA+AGG	-	chr7_4:58097290-58097309	None:intergenic	45.0%
!	CATAGGGATCTGTCTCCTTT+TGG	-	chr7_4:58097296-58097315	None:intergenic	45.0%
	TTTGATGGAGGTTCAAGCTC+TGG	+	chr7_4:58097844-58097863	Msa1166090:CDS	45.0%
!!	GGTTCAAGCATTGATGGAGT+AGG	+	chr7_4:58097906-58097925	Msa1166090:intron	45.0%
	GGAAACCATGGCAAAAACGA+TGG	-	chr7_4:58098221-58098240	None:intergenic	45.0%
	TGATAGTAGCCTTCCGATTG+AGG	+	chr7_4:58098446-58098465	Msa1166090:CDS	45.0%
	TGACATCCTGATTCTGGCAT+AGG	-	chr7_4:58098585-58098604	None:intergenic	45.0%
	ATTGCAATGAATGACCAGGC+AGG	-	chr7_4:58098641-58098660	None:intergenic	45.0%
!	GTGGTTTGTAGACTTGTAGG+AGG	+	chr7_4:58098771-58098790	Msa1166090:intron	45.0%
	CTTAAGGCCCTGTCGAAAAT+TGG	-	chr7_4:58099431-58099450	None:intergenic	45.0%
!!	GATCAGTGTCGATTGTGTCA+TGG	+	chr7_4:58099523-58099542	Msa1166090:three_prime_UTR	45.0%
!!	ATCGAGAAGGTTCTGGAAGG+CGG	-	chr7_4:58095119-58095138	None:intergenic	50.0%
	ACCCTGCAGTCTCTTCTAAG+TGG	-	chr7_4:58095968-58095987	None:intergenic	50.0%
	ATGCACAATTGGGAGGTCAC+TGG	-	chr7_4:58096174-58096193	None:intergenic	50.0%
	CCCCATTATGCACAATTGGG+AGG	-	chr7_4:58096181-58096200	None:intergenic	50.0%
	GTCAGACCGGCAATGTTGTA+TGG	+	chr7_4:58096336-58096355	Msa1166090:intron	50.0%
!	AAGTAAGCGTAGCGGAGATG+AGG	+	chr7_4:58096397-58096416	Msa1166090:intron	50.0%
	AGGATGTTGCGTTGGATGAG+TGG	+	chr7_4:58096417-58096436	Msa1166090:intron	50.0%
	TCTTCTTACCACGGCGTCTA+CGG	-	chr7_4:58096562-58096581	None:intergenic	50.0%
	CTTATCCCACTAAGTGGGGT+CGG	-	chr7_4:58096736-58096755	None:intergenic	50.0%
!	GAGCCTTATCCCACTAAGTG+GGG	-	chr7_4:58096740-58096759	None:intergenic	50.0%
!	CGAGCCTTATCCCACTAAGT+GGG	-	chr7_4:58096741-58096760	None:intergenic	50.0%
	CCACTTAGTGGGATAAGGCT+CGG	+	chr7_4:58096739-58096758	Msa1166090:intron	50.0%
!	GCTCGGTTGTTGTTGTTGTC+TGG	+	chr7_4:58096756-58096775	Msa1166090:intron	50.0%
	CCAGAAAAGGTAGGGCTAAG+AGG	-	chr7_4:58097093-58097112	None:intergenic	50.0%
!	CCTCTTAGCCCTACCTTTTC+TGG	+	chr7_4:58097090-58097109	Msa1166090:CDS	50.0%
	TGGTAAGGACTCTGTTGCAG+AGG	+	chr7_4:58097137-58097156	Msa1166090:CDS	50.0%
!!	GACACATAGTTCTGGGCCTT+CGG	-	chr7_4:58097198-58097217	None:intergenic	50.0%
	TGCAGCTACATTGCGTTGCA+GGG	+	chr7_4:58097224-58097243	Msa1166090:CDS	50.0%
	GGGTTACTAAAGCAAGGAGG+AGG	-	chr7_4:58097255-58097274	None:intergenic	50.0%
	ACGCAGTACACAGTTACAGC+TGG	+	chr7_4:58097728-58097747	Msa1166090:CDS	50.0%
!	GTTCAAGCTCTGGCAGCATT+GGG	+	chr7_4:58097854-58097873	Msa1166090:CDS	50.0%
	GGCTCCGAGTTATTAGCAGA+AGG	+	chr7_4:58098082-58098101	Msa1166090:CDS	50.0%
!!	GTCGTCCATCGTTTTTGCCA+TGG	+	chr7_4:58098213-58098232	Msa1166090:intron	50.0%
	AGTAGCCTTCCGATTGAGGA+AGG	+	chr7_4:58098450-58098469	Msa1166090:CDS	50.0%
	CATCTCCTTCCTCAATCGGA+AGG	-	chr7_4:58098458-58098477	None:intergenic	50.0%
	CGTGCATCTCCTTCCTCAAT+CGG	-	chr7_4:58098462-58098481	None:intergenic	50.0%
	AGATGCACGTTATATGCCCC+AGG	+	chr7_4:58098473-58098492	Msa1166090:CDS	50.0%
	AATGAATGACCAGGCAGGAG+TGG	-	chr7_4:58098636-58098655	None:intergenic	50.0%
	AACCGGATCAGGATCGATCA+TGG	-	chr7_4:58099375-58099394	None:intergenic	50.0%
	TCGATCCTGATCCGGTTAAG+AGG	+	chr7_4:58099378-58099397	Msa1166090:CDS	50.0%
	TCTACCAACTCTCTGGCAGA+AGG	-	chr7_4:58099404-58099423	None:intergenic	50.0%
	TGGGTTCTCTACCAACTCTC+TGG	-	chr7_4:58099411-58099430	None:intergenic	50.0%
!	TAGACAGATGATGGTCCAGC+AGG	-	chr7_4:58099495-58099514	None:intergenic	50.0%
	CACCTGATAATTCTCGCGCA+TGG	+	chr7_4:58099581-58099600	Msa1166090:three_prime_UTR	50.0%
	CACCATGCGCGAGAATTATC+AGG	-	chr7_4:58099586-58099605	None:intergenic	50.0%
	GTCTTTCTCTACCCAACTGG+AGG	-	chr7_4:58099735-58099754	None:intergenic	50.0%
!!	GGAAGGAAGAAGGCACCACT+CGG	+	chr7_4:58095004-58095023	Msa1166090:CDS	55.0%
!	CTTGTGTTACTCGCACCGAG+TGG	-	chr7_4:58095022-58095041	None:intergenic	55.0%
	GGGCAAGGGCTATTATCCTG+CGG	-	chr7_4:58095494-58095513	None:intergenic	55.0%
	TAGCCCTTGCCCTAAATCCC+CGG	+	chr7_4:58095502-58095521	Msa1166090:CDS	55.0%
!	TCTCCGGGGATTTAGGGCAA+GGG	-	chr7_4:58095508-58095527	None:intergenic	55.0%
!	TTCTCCGGGGATTTAGGGCA+AGG	-	chr7_4:58095509-58095528	None:intergenic	55.0%
	CTATCGGACAGCAGTCAGAC+CGG	+	chr7_4:58096323-58096342	Msa1166090:intron	55.0%
!!	GTATGGTACGGAGTGTTGGG+CGG	+	chr7_4:58096353-58096372	Msa1166090:intron	55.0%
	CGGAGATGAGGATGTTGCGT+TGG	+	chr7_4:58096409-58096428	Msa1166090:intron	55.0%
	CTTCTTACCACGGCGTCTAC+GGG	-	chr7_4:58096561-58096580	None:intergenic	55.0%
	ACTAAGTGGGGTCGGCTACA+TGG	-	chr7_4:58096728-58096747	None:intergenic	55.0%
	ATGTAGCCGACCCCACTTAG+TGG	+	chr7_4:58096727-58096746	Msa1166090:intron	55.0%
	TGTAGCCGACCCCACTTAGT+GGG	+	chr7_4:58096728-58096747	Msa1166090:intron	55.0%
	CGACCCCACTTAGTGGGATA+AGG	+	chr7_4:58096734-58096753	Msa1166090:intron	55.0%
!	CCGAGCCTTATCCCACTAAG+TGG	-	chr7_4:58096742-58096761	None:intergenic	55.0%
	CTGCAGCTACATTGCGTTGC+AGG	+	chr7_4:58097223-58097242	Msa1166090:CDS	55.0%
!	GGTTCAAGCTCTGGCAGCAT+TGG	+	chr7_4:58097853-58097872	Msa1166090:CDS	55.0%
	GGCCATGATCGATCCTGATC+CGG	+	chr7_4:58099370-58099389	Msa1166090:intron	55.0%
	GAAGGCCTCTTAACCGGATC+AGG	-	chr7_4:58099386-58099405	None:intergenic	55.0%
	CTGGCAGAAGGCCTCTTAAC+CGG	-	chr7_4:58099392-58099411	None:intergenic	55.0%
	GGCTCCCATTTCCCACCACA+TGG	+	chr7_4:58096961-58096980	Msa1166090:intron	60.0%
	GGTAGCTGCTGGTAAGCCGA+AGG	+	chr7_4:58097179-58097198	Msa1166090:CDS	60.0%
	GAGGCCTTCTGCCAGAGAGT+TGG	+	chr7_4:58099397-58099416	Msa1166090:CDS	60.0%
	GAGAAGACCCGTAGACGCCG+TGG	+	chr7_4:58096551-58096570	Msa1166090:intron	65.0%
	GGCAAGTTGCCACTCCTGCC+TGG	+	chr7_4:58098624-58098643	Msa1166090:CDS	65.0%

Chromosome	Type	Strat	End	Strand	Name
chr7_4	gene	58094905	58099754	58094905	ID=Msa1166090;Name=Msa1166090
chr7_4	mRNA	58094905	58099754	58094905	ID=Msa1166090-mRNA-1;Parent=Msa1166090;Name=Msa1166090-mRNA-1;_AED=0.12;_eAED=0.12;_QI=72\|1\|1\|1\|1\|1\|10\|288\|487
chr7_4	exon	58094905	58095230	58094905	ID=Msa1166090-mRNA-1:exon:17738;Parent=Msa1166090-mRNA-1
chr7_4	exon	58095332	58095392	58095332	ID=Msa1166090-mRNA-1:exon:17739;Parent=Msa1166090-mRNA-1
chr7_4	exon	58095497	58095563	58095497	ID=Msa1166090-mRNA-1:exon:17740;Parent=Msa1166090-mRNA-1
chr7_4	exon	58097073	58097339	58097073	ID=Msa1166090-mRNA-1:exon:17741;Parent=Msa1166090-mRNA-1
chr7_4	exon	58097478	58097545	58097478	ID=Msa1166090-mRNA-1:exon:17742;Parent=Msa1166090-mRNA-1
chr7_4	exon	58097654	58097760	58097654	ID=Msa1166090-mRNA-1:exon:17743;Parent=Msa1166090-mRNA-1
chr7_4	exon	58097835	58097875	58097835	ID=Msa1166090-mRNA-1:exon:17744;Parent=Msa1166090-mRNA-1
chr7_4	exon	58097981	58098129	58097981	ID=Msa1166090-mRNA-1:exon:17745;Parent=Msa1166090-mRNA-1
chr7_4	exon	58098324	58098677	58098324	ID=Msa1166090-mRNA-1:exon:17746;Parent=Msa1166090-mRNA-1
chr7_4	exon	58099371	58099754	58099371	ID=Msa1166090-mRNA-1:exon:17747;Parent=Msa1166090-mRNA-1
chr7_4	five_prime_UTR	58094905	58094976	58094905	ID=Msa1166090-mRNA-1:five_prime_utr;Parent=Msa1166090-mRNA-1
chr7_4	CDS	58094977	58095230	58094977	ID=Msa1166090-mRNA-1:cds;Parent=Msa1166090-mRNA-1
chr7_4	CDS	58095332	58095392	58095332	ID=Msa1166090-mRNA-1:cds;Parent=Msa1166090-mRNA-1
chr7_4	CDS	58095497	58095563	58095497	ID=Msa1166090-mRNA-1:cds;Parent=Msa1166090-mRNA-1
chr7_4	CDS	58097073	58097339	58097073	ID=Msa1166090-mRNA-1:cds;Parent=Msa1166090-mRNA-1
chr7_4	CDS	58097478	58097545	58097478	ID=Msa1166090-mRNA-1:cds;Parent=Msa1166090-mRNA-1
chr7_4	CDS	58097654	58097760	58097654	ID=Msa1166090-mRNA-1:cds;Parent=Msa1166090-mRNA-1
chr7_4	CDS	58097835	58097875	58097835	ID=Msa1166090-mRNA-1:cds;Parent=Msa1166090-mRNA-1
chr7_4	CDS	58097981	58098129	58097981	ID=Msa1166090-mRNA-1:cds;Parent=Msa1166090-mRNA-1
chr7_4	CDS	58098324	58098677	58098324	ID=Msa1166090-mRNA-1:cds;Parent=Msa1166090-mRNA-1
chr7_4	CDS	58099371	58099466	58099371	ID=Msa1166090-mRNA-1:cds;Parent=Msa1166090-mRNA-1
chr7_4	three_prime_UTR	58099467	58099754	58099467	ID=Msa1166090-mRNA-1:three_prime_utr;Parent=Msa1166090-mRNA-1

Gene Sequence

>Msa1166090

ATGACGAGAAAAACCCCAAAATCAAGGGGAAGGAAGAAGGCACCACTCGGTGCGAGTAACACAAGACAGTTACAGCTTCAGCTCAGCAAATTCTCTTTCAAACAATACAAACCGTTACCAACAACGACTATAACTTCTTCCGCCTTCCAGAACCTTCTCGATTCAGAGACAAATCAAAATCCTTCCATTAGGGTTACCAATGATGCTACCGATGCTGATTCAAGAGATGGCATTCTTAGTCAAGATTTCTTCTGTACTCCAGATTACATAACTCCGGATAATCAGCGGATTTTGAACGGTATCGATTTCAATAAGGATAATAGCCCTTGCCCTAAATCCCCGGAGAAATTGAATACTACTAAAAGCAAAAGATGTCGACTGGATGGTGTCTCGGCAAACCCTCTTAGCCCTACCTTTTCTGGTGACCATCAACAAGTTGTGGAACTTGGTAAGGACTCTGTTGCAGAGGAAGTAGCTGTTGATATAACGGTAGCTGCTGGTAAGCCGAAGGCCCAGAACTATGTGTCACATTCTGCAGCTACATTGCGTTGCAGGGCTATACCTCCTCCTTGCTTTAGTAACCCCTATTTAAAGGACCTTTCCCAAAAGGAGACAGATCCCTATGCAAACCAAAGATCCAAATGTGCAGGTTTCTTCCCTAAATTTACAGCTTATGATGGGCTCTCACGCTATCGCACTGACTTTCATGAGATTGAGCAAATTGGTCGAGGGTACTTTAGTTGTGTTTTTAAAGTATTAAAGCGAATAGATGGCTGCTTGTATGCTGTGAAACGCAGTACACAGTTACAGCTGGATACAGAAAGGAGAAAAGCTTTGATGGAGGTTCAAGCTCTGGCAGCATTGGGTTACCATGAGAACATTGTGGGCTATTATACTTCATGGTTTGAAAACGAACAACTGTACATTCAGATGGAGATATGTGATCATAGCTTATCTGTAAACAAAGGCTCCGAGTTATTAGCAGAAGGACAAGTGTTAGAAGTTTTATATCAAGTTGCTAATGCACTGCGATTTATACACGACAAGGGAATAGCTCATCTTGATCTTAAACCTGATAATATTTATGTAAAAAATGGTGTCTATAAGCTTGGTGATTTTGGATGTGCAACTCTTACTGATAGTAGCCTTCCGATTGAGGAAGGAGATGCACGTTATATGCCCCAGGAAATCCTTAATGAGAATTATGACCACCTTGACAAGGTTGATATTTTCTCTTTGGGAGTTTCTATTTATCAACTCATCCGAAAATCACCTATGCCAGAATCAGGATGTCATTTTTTGAATCTTAAAGAAGGCAAGTTGCCACTCCTGCCTGGTCATTCATTGCAATTTCAAAACTTGCTCAAGGCCATGATCGATCCTGATCCGGTTAAGAGGCCTTCTGCCAGAGAGTTGGTAGAGAACCCAATTTTCGACAGGGCCTTAAGAACAGCGAAAAATTGA

Protein sequence

>Msa1166090

MTRKTPKSRGRKKAPLGASNTRQLQLQLSKFSFKQYKPLPTTTITSSAFQNLLDSETNQNPSIRVTNDATDADSRDGILSQDFFCTPDYITPDNQRILNGIDFNKDNSPCPKSPEKLNTTKSKRCRLDGVSANPLSPTFSGDHQQVVELGKDSVAEEVAVDITVAAGKPKAQNYVSHSAATLRCRAIPPPCFSNPYLKDLSQKETDPYANQRSKCAGFFPKFTAYDGLSRYRTDFHEIEQIGRGYFSCVFKVLKRIDGCLYAVKRSTQLQLDTERRKALMEVQALAALGYHENIVGYYTSWFENEQLYIQMEICDHSLSVNKGSELLAEGQVLEVLYQVANALRFIHDKGIAHLDLKPDNIYVKNGVYKLGDFGCATLTDSSLPIEEGDARYMPQEILNENYDHLDKVDIFSLGVSIYQLIRKSPMPESGCHFLNLKEGKLPLLPGHSLQFQNLLKAMIDPDPVKRPSARELVENPIFDRALRTAKN*