AlfalfaGEDB | Msa0352120

M. sativa cultivar zhongmu-4 / Msa0352120

KEGG: K01188|K22279
GO: GO:0003674 GO:0003824 GO:0004553 GO:0008150 GO:0008152 GO:0008422 GO:0015926 GO:0016787 GO:0016798 GO:0071704 GO:1901135 GO:1901657
PFAM: PF00232.21

Nr:

Query id	Subject id	identity %	alignment length	mis matches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa0352120	XP_013459129.1	95.303	511	24	0	14	524	1	511	0.0	1008

Swissprot:

Query id	Subject id	identity %	alignment length	mis matches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa0352120	sp\|A2SY66\|VICHY_VICSN	80.747	509	95	2	17	522	1	509	0.0	859

Trembl:

Query id	Subject id	identity %	alignment length	mis matches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa0352120	A0A072UU47	95.303	511	24	0	14	524	1	511	0.0	1008

TFs/TRs:

Gene ID	Type	Classification

Protein Kinases:

Gene ID	Type	Classification

Network:

Co-expression Network

Gene1	Gene2	correlation coefficient	p_value	FDR
Msa0000180	Msa0352120	0.830938	2.215364e-55	-8.615850e-47
Msa0001420	Msa0352120	0.809354	1.972793e-50	-8.615850e-47
Msa0001540	Msa0352120	0.800989	1.112284e-48	-8.615850e-47
Msa0009210	Msa0352120	0.858304	9.030934e-63	-8.615850e-47
Msa0011910	Msa0352120	0.816454	5.483424e-52	-8.615850e-47
Msa0018220	Msa0352120	0.808611	2.845246e-50	-8.615850e-47
Msa0024070	Msa0352120	0.826171	3.140072e-54	-8.615850e-47
Msa0025830	Msa0352120	0.814180	1.757143e-51	-8.615850e-47
Msa0028410	Msa0352120	0.800918	1.150491e-48	-8.615850e-47
Msa0028450	Msa0352120	0.816978	4.183818e-52	-8.615850e-47
Msa0028940	Msa0352120	0.806860	6.699909e-50	-8.615850e-47
Msa0030740	Msa0352120	0.816404	5.626888e-52	-8.615850e-47
Msa0032350	Msa0352120	0.817153	3.821510e-52	-8.615850e-47
Msa0032700	Msa0352120	0.817034	4.065604e-52	-8.615850e-47
Msa0033580	Msa0352120	0.816245	6.107696e-52	-8.615850e-47
Msa0034320	Msa0352120	0.803588	3.245528e-49	-8.615850e-47
Msa0035090	Msa0352120	0.823288	1.501310e-53	-8.615850e-47
Msa0036620	Msa0352120	0.801444	8.978066e-49	-8.615850e-47
Msa0044380	Msa0352120	0.831086	2.037801e-55	-8.615850e-47
Msa0045530	Msa0352120	0.839850	1.238328e-57	-8.615850e-47
Msa0046090	Msa0352120	0.813885	2.040914e-51	-8.615850e-47
Msa0046860	Msa0352120	0.837279	5.708841e-57	-8.615850e-47
Msa0050560	Msa0352120	0.813905	2.020084e-51	-8.615850e-47
Msa0052460	Msa0352120	0.804620	1.979119e-49	-8.615850e-47
Msa0052550	Msa0352120	0.801797	7.600773e-49	-8.615850e-47
Msa0053680	Msa0352120	0.816005	6.911463e-52	-8.615850e-47
Msa0056130	Msa0352120	0.803799	2.933397e-49	-8.615850e-47
Msa0058140	Msa0352120	0.815351	9.667736e-52	-8.615850e-47
Msa0058970	Msa0352120	0.853140	2.908835e-61	-8.615850e-47
Msa0060720	Msa0352120	0.845972	2.908161e-59	-8.615850e-47
Msa0067820	Msa0352120	0.820496	6.653386e-53	-8.615850e-47
Msa0072710	Msa0352120	0.801897	7.250593e-49	-8.615850e-47
Msa0073350	Msa0352120	0.810661	1.031484e-50	-8.615850e-47
Msa0077990	Msa0352120	0.805309	1.420511e-49	-8.615850e-47
Msa0078080	Msa0352120	0.833120	6.398521e-56	-8.615850e-47
Msa0079530	Msa0352120	0.831849	1.322082e-55	-8.615850e-47
Msa0081300	Msa0352120	0.811138	8.132222e-51	-8.615850e-47
Msa0081920	Msa0352120	-0.806769	7.003049e-50	-8.615850e-47
Msa0083570	Msa0352120	0.816311	5.904458e-52	-8.615850e-47
Msa0089410	Msa0352120	0.816753	4.700640e-52	-8.615850e-47
Msa0092730	Msa0352120	0.802035	6.791347e-49	-8.615850e-47
Msa0092750	Msa0352120	0.835363	1.753102e-56	-8.615850e-47
Msa0093830	Msa0352120	0.841398	4.869667e-58	-8.615850e-47
Msa0094060	Msa0352120	0.815604	8.490222e-52	-8.615850e-47
Msa0094700	Msa0352120	0.811192	7.915276e-51	-8.615850e-47
Msa0097050	Msa0352120	0.809914	1.495374e-50	-8.615850e-47
Msa0097490	Msa0352120	0.809167	2.163413e-50	-8.615850e-47
Msa0103780	Msa0352120	0.826164	3.152540e-54	-8.615850e-47
Msa0114960	Msa0352120	0.820278	7.463320e-53	-8.615850e-47
Msa0118250	Msa0352120	0.803572	3.269425e-49	-8.615850e-47
Msa0123900	Msa0352120	0.827854	1.243171e-54	-8.615850e-47
Msa0124070	Msa0352120	0.812707	3.701566e-51	-8.615850e-47
Msa0127110	Msa0352120	0.806492	8.013720e-50	-8.615850e-47
Msa0128840	Msa0352120	0.824054	9.935402e-54	-8.615850e-47
Msa0130120	Msa0352120	0.822665	2.097953e-53	-8.615850e-47
Msa0131640	Msa0352120	0.812866	3.417801e-51	-8.615850e-47
Msa0132590	Msa0352120	-0.821585	3.732994e-53	-8.615850e-47
Msa0136520	Msa0352120	0.809202	2.125602e-50	-8.615850e-47
Msa0137600	Msa0352120	0.801785	7.641609e-49	-8.615850e-47
Msa0140330	Msa0352120	0.819621	1.055115e-52	-8.615850e-47
Msa0143490	Msa0352120	0.848222	7.034451e-60	-8.615850e-47
Msa0147070	Msa0352120	0.803164	3.973241e-49	-8.615850e-47
Msa0150210	Msa0352120	0.814403	1.568224e-51	-8.615850e-47
Msa0151780	Msa0352120	0.847576	1.059840e-59	-8.615850e-47
Msa0151790	Msa0352120	0.816021	6.853533e-52	-8.615850e-47
Msa0163170	Msa0352120	0.808952	2.405280e-50	-8.615850e-47
Msa0168390	Msa0352120	0.807761	4.315854e-50	-8.615850e-47
Msa0168950	Msa0352120	0.805915	1.059751e-49	-8.615850e-47
Msa0170550	Msa0352120	0.823217	1.559803e-53	-8.615850e-47
Msa0172820	Msa0352120	0.808146	3.574867e-50	-8.615850e-47
Msa0173610	Msa0352120	0.800649	1.305088e-48	-8.615850e-47
Msa0175900	Msa0352120	0.804481	2.116366e-49	-8.615850e-47
Msa0181380	Msa0352120	0.816961	4.222139e-52	-8.615850e-47
Msa0183490	Msa0352120	0.835363	1.753102e-56	-8.615850e-47
Msa0184070	Msa0352120	0.817887	2.612214e-52	-8.615850e-47
Msa0185550	Msa0352120	0.825583	4.331026e-54	-8.615850e-47
Msa0185770	Msa0352120	0.822210	2.675584e-53	-8.615850e-47
Msa0186750	Msa0352120	0.802101	6.582015e-49	-8.615850e-47
Msa0187560	Msa0352120	0.822139	2.778720e-53	-8.615850e-47
Msa0190000	Msa0352120	0.824850	6.455052e-54	-8.615850e-47
Msa0192020	Msa0352120	0.804313	2.293864e-49	-8.615850e-47
Msa0196620	Msa0352120	0.822290	2.564544e-53	-8.615850e-47
Msa0202630	Msa0352120	0.816545	5.231834e-52	-8.615850e-47
Msa0204000	Msa0352120	0.803624	3.189940e-49	-8.615850e-47
Msa0206600	Msa0352120	0.807488	4.932071e-50	-8.615850e-47
Msa0206970	Msa0352120	0.836193	1.080041e-56	-8.615850e-47
Msa0216900	Msa0352120	0.838937	2.136536e-57	-8.615850e-47
Msa0219550	Msa0352120	0.807274	5.475473e-50	-8.615850e-47
Msa0224980	Msa0352120	0.825201	5.332467e-54	-8.615850e-47
Msa0225030	Msa0352120	0.824633	7.263767e-54	-8.615850e-47
Msa0227960	Msa0352120	0.823046	1.709739e-53	-8.615850e-47
Msa0231180	Msa0352120	0.811847	5.703674e-51	-8.615850e-47
Msa0232160	Msa0352120	0.817876	2.626284e-52	-8.615850e-47
Msa0234930	Msa0352120	0.814021	1.904442e-51	-8.615850e-47
Msa0235180	Msa0352120	0.800003	1.766752e-48	-8.615850e-47
Msa0236100	Msa0352120	0.802064	6.698515e-49	-8.615850e-47
Msa0236330	Msa0352120	0.805809	1.115514e-49	-8.615850e-47
Msa0236350	Msa0352120	0.840284	9.537965e-58	-8.615850e-47
Msa0245690	Msa0352120	0.804033	2.622813e-49	-8.615850e-47
Msa0253410	Msa0352120	0.821594	3.715389e-53	-8.615850e-47
Msa0258380	Msa0352120	0.804151	2.479265e-49	-8.615850e-47
Msa0258410	Msa0352120	0.803610	3.210575e-49	-8.615850e-47
Msa0263470	Msa0352120	0.802489	5.474762e-49	-8.615850e-47
Msa0265440	Msa0352120	0.808177	3.519643e-50	-8.615850e-47
Msa0265780	Msa0352120	0.813427	2.573378e-51	-8.615850e-47
Msa0266010	Msa0352120	0.834829	2.390462e-56	-8.615850e-47
Msa0266100	Msa0352120	0.846020	2.823796e-59	-8.615850e-47
Msa0268160	Msa0352120	0.811619	6.393713e-51	-8.615850e-47
Msa0269830	Msa0352120	0.822228	2.650476e-53	-8.615850e-47
Msa0273270	Msa0352120	0.813826	2.102828e-51	-8.615850e-47
Msa0274000	Msa0352120	0.816195	6.267685e-52	-8.615850e-47
Msa0274870	Msa0352120	0.843256	1.566914e-58	-8.615850e-47
Msa0274890	Msa0352120	0.801114	1.048736e-48	-8.615850e-47
Msa0275260	Msa0352120	0.815167	1.061885e-51	-8.615850e-47
Msa0276030	Msa0352120	0.801932	7.131498e-49	-8.615850e-47
Msa0278720	Msa0352120	0.852956	3.283809e-61	-8.615850e-47
Msa0281310	Msa0352120	0.808673	2.759081e-50	-8.615850e-47
Msa0284260	Msa0352120	0.838035	3.651550e-57	-8.615850e-47
Msa0284980	Msa0352120	0.814526	1.473354e-51	-8.615850e-47
Msa0285710	Msa0352120	0.801513	8.689179e-49	-8.615850e-47
Msa0288300	Msa0352120	0.821375	4.175600e-53	-8.615850e-47
Msa0288350	Msa0352120	0.824520	7.720487e-54	-8.615850e-47
Msa0288360	Msa0352120	0.836490	9.078847e-57	-8.615850e-47
Msa0290040	Msa0352120	0.823646	1.238321e-53	-8.615850e-47
Msa0296100	Msa0352120	0.848171	7.265540e-60	-8.615850e-47
Msa0296640	Msa0352120	0.820478	6.714191e-53	-8.615850e-47
Msa0302660	Msa0352120	0.803275	3.768585e-49	-8.615850e-47
Msa0303780	Msa0352120	0.817774	2.769228e-52	-8.615850e-47
Msa0303950	Msa0352120	0.825023	5.877280e-54	-8.615850e-47
Msa0304020	Msa0352120	0.834917	2.271264e-56	-8.615850e-47
Msa0305810	Msa0352120	0.820920	5.313747e-53	-8.615850e-47
Msa0307490	Msa0352120	0.836089	1.147514e-56	-8.615850e-47
Msa0307750	Msa0352120	0.836815	7.501134e-57	-8.615850e-47
Msa0310260	Msa0352120	0.808709	2.711121e-50	-8.615850e-47
Msa0313550	Msa0352120	0.803492	3.397300e-49	-8.615850e-47
Msa0314620	Msa0352120	0.817083	3.962922e-52	-8.615850e-47
Msa0315760	Msa0352120	0.804764	1.846971e-49	-8.615850e-47
Msa0316330	Msa0352120	0.800081	1.703552e-48	-8.615850e-47
Msa0321100	Msa0352120	0.803697	3.079999e-49	-8.615850e-47
Msa0322970	Msa0352120	0.802904	4.495678e-49	-8.615850e-47
Msa0323790	Msa0352120	0.805881	1.077372e-49	-8.615850e-47
Msa0324630	Msa0352120	0.819620	1.055500e-52	-8.615850e-47
Msa0327870	Msa0352120	0.807934	3.965515e-50	-8.615850e-47
Msa0334480	Msa0352120	0.814655	1.379437e-51	-8.615850e-47
Msa0335740	Msa0352120	0.808016	3.809607e-50	-8.615850e-47
Msa0338610	Msa0352120	0.801833	7.470654e-49	-8.615850e-47
Msa0341710	Msa0352120	0.837484	5.060024e-57	-8.615850e-47
Msa0347060	Msa0352120	0.810034	1.408760e-50	-8.615850e-47
Msa0347600	Msa0352120	0.854857	9.307365e-62	-8.615850e-47
Msa0349450	Msa0352120	0.818558	1.841083e-52	-8.615850e-47
Msa0352120	Msa0353890	0.847936	8.434448e-60	-8.615850e-47
Msa0352120	Msa0358230	0.818857	1.574730e-52	-8.615850e-47
Msa0352120	Msa0361500	0.818335	2.068406e-52	-8.615850e-47
Msa0352120	Msa0367370	0.820910	5.343922e-53	-8.615850e-47
Msa0352120	Msa0368430	0.834728	2.533736e-56	-8.615850e-47
Msa0352120	Msa0369770	0.816806	4.574076e-52	-8.615850e-47
Msa0352120	Msa0370180	0.805688	1.182872e-49	-8.615850e-47
Msa0352120	Msa0370690	0.807270	5.486577e-50	-8.615850e-47
Msa0352120	Msa0371050	0.838884	2.205277e-57	-8.615850e-47
Msa0352120	Msa0371640	0.844330	8.084850e-59	-8.615850e-47
Msa0352120	Msa0372550	0.819103	1.384182e-52	-8.615850e-47
Msa0352120	Msa0376760	0.813637	2.314112e-51	-8.615850e-47
Msa0352120	Msa0378910	-0.807167	5.768997e-50	-8.615850e-47
Msa0352120	Msa0379090	0.801907	7.215049e-49	-8.615850e-47
Msa0352120	Msa0379450	0.806996	6.271287e-50	-8.615850e-47
Msa0352120	Msa0379900	0.807908	4.015782e-50	-8.615850e-47
Msa0352120	Msa0380420	0.805083	1.584365e-49	-8.615850e-47
Msa0352120	Msa0381990	0.804464	2.133511e-49	-8.615850e-47
Msa0352120	Msa0382290	0.803090	4.115442e-49	-8.615850e-47
Msa0352120	Msa0383110	0.803183	3.935906e-49	-8.615850e-47
Msa0352120	Msa0383570	0.812749	3.624838e-51	-8.615850e-47
Msa0352120	Msa0383880	0.825609	4.269473e-54	-8.615850e-47
Msa0352120	Msa0384570	0.807001	6.255915e-50	-8.615850e-47
Msa0352120	Msa0385400	0.809047	2.295469e-50	-8.615850e-47
Msa0352120	Msa0387120	0.808470	3.049279e-50	-8.615850e-47
Msa0352120	Msa0388000	0.836383	9.665702e-57	-8.615850e-47
Msa0352120	Msa0392480	0.802739	4.864003e-49	-8.615850e-47
Msa0352120	Msa0394330	0.817444	3.287734e-52	-8.615850e-47
Msa0352120	Msa0398990	0.938052	1.270944e-98	-8.615850e-47
Msa0352120	Msa0399180	0.812608	3.890898e-51	-8.615850e-47
Msa0352120	Msa0400880	0.815952	7.102243e-52	-8.615850e-47
Msa0352120	Msa0404840	0.836364	9.771609e-57	-8.615850e-47
Msa0352120	Msa0404900	0.805992	1.021179e-49	-8.615850e-47
Msa0352120	Msa0409000	0.806137	9.517930e-50	-8.615850e-47
Msa0352120	Msa0412470	0.815229	1.028886e-51	-8.615850e-47
Msa0352120	Msa0415460	0.809847	1.545639e-50	-8.615850e-47
Msa0352120	Msa0415860	0.807013	6.218785e-50	-8.615850e-47
Msa0352120	Msa0415930	0.825066	5.740418e-54	-8.615850e-47
Msa0352120	Msa0417140	0.802474	5.514170e-49	-8.615850e-47
Msa0352120	Msa0418480	0.817131	3.866937e-52	-8.615850e-47
Msa0352120	Msa0420070	0.809372	1.955281e-50	-8.615850e-47
Msa0352120	Msa0420100	0.846222	2.486977e-59	-8.615850e-47
Msa0352120	Msa0421790	0.816609	5.062390e-52	-8.615850e-47
Msa0352120	Msa0431310	0.827926	1.194284e-54	-8.615850e-47
Msa0352120	Msa0434630	0.807521	4.853701e-50	-8.615850e-47
Msa0352120	Msa0436310	0.808234	3.423551e-50	-8.615850e-47
Msa0352120	Msa0438990	0.805377	1.374492e-49	-8.615850e-47
Msa0352120	Msa0439780	0.826194	3.101096e-54	-8.615850e-47
Msa0352120	Msa0440090	0.815914	7.242829e-52	-8.615850e-47
Msa0352120	Msa0447820	0.855319	6.832098e-62	-8.615850e-47
Msa0352120	Msa0450780	0.824471	7.927015e-54	-8.615850e-47
Msa0352120	Msa0450830	0.802225	6.205522e-49	-8.615850e-47
Msa0352120	Msa0450860	0.835016	2.144402e-56	-8.615850e-47
Msa0352120	Msa0450920	0.806788	6.938976e-50	-8.615850e-47
Msa0352120	Msa0456940	0.839616	1.424465e-57	-8.615850e-47
Msa0352120	Msa0457750	0.949039	2.842883e-107	-8.615850e-47
Msa0352120	Msa0458110	0.812830	3.480065e-51	-8.615850e-47
Msa0352120	Msa0459920	0.800073	1.709853e-48	-8.615850e-47
Msa0352120	Msa0463140	0.832900	7.261365e-56	-8.615850e-47
Msa0352120	Msa0463580	0.804027	2.630257e-49	-8.615850e-47
Msa0352120	Msa0463980	0.820627	6.206865e-53	-8.615850e-47
Msa0352120	Msa0465860	0.825106	5.616973e-54	-8.615850e-47
Msa0352120	Msa0466070	0.847561	1.069822e-59	-8.615850e-47
Msa0352120	Msa0467890	0.823960	1.045558e-53	-8.615850e-47
Msa0352120	Msa0467970	0.814981	1.168038e-51	-8.615850e-47
Msa0352120	Msa0471700	0.816489	5.386627e-52	-8.615850e-47
Msa0352120	Msa0474860	-0.802775	4.779577e-49	-8.615850e-47
Msa0352120	Msa0475130	0.800523	1.384580e-48	-8.615850e-47
Msa0352120	Msa0476150	0.827393	1.603928e-54	-8.615850e-47
Msa0352120	Msa0476180	0.823423	1.396308e-53	-8.615850e-47
Msa0352120	Msa0476490	0.815259	1.013375e-51	-8.615850e-47
Msa0352120	Msa0476820	0.829002	6.565500e-55	-8.615850e-47
Msa0352120	Msa0480150	0.812551	4.004628e-51	-8.615850e-47
Msa0352120	Msa0481620	0.822954	1.796653e-53	-8.615850e-47
Msa0352120	Msa0485350	0.837769	4.275521e-57	-8.615850e-47
Msa0352120	Msa0486200	0.848436	6.136936e-60	-8.615850e-47
Msa0352120	Msa0486240	0.830701	2.531501e-55	-8.615850e-47
Msa0352120	Msa0489620	0.819310	1.241868e-52	-8.615850e-47
Msa0352120	Msa0493550	0.943852	5.685893e-103	-8.615850e-47
Msa0352120	Msa0498090	0.826609	2.469562e-54	-8.615850e-47
Msa0352120	Msa0498250	0.808701	2.721221e-50	-8.615850e-47
Msa0352120	Msa0501920	0.814283	1.667381e-51	-8.615850e-47
Msa0352120	Msa0506740	0.805208	1.491501e-49	-8.615850e-47
Msa0352120	Msa0508620	0.800517	1.388678e-48	-8.615850e-47
Msa0352120	Msa0508660	0.804021	2.638200e-49	-8.615850e-47
Msa0352120	Msa0509530	0.817296	3.549966e-52	-8.615850e-47
Msa0352120	Msa0510230	0.825706	4.049027e-54	-8.615850e-47
Msa0352120	Msa0511930	0.840275	9.589476e-58	-8.615850e-47
Msa0352120	Msa0516330	0.831084	2.039253e-55	-8.615850e-47
Msa0352120	Msa0517300	0.815376	9.542576e-52	-8.615850e-47
Msa0352120	Msa0520450	0.835864	1.308833e-56	-8.615850e-47
Msa0352120	Msa0520730	0.809391	1.937007e-50	-8.615850e-47
Msa0352120	Msa0521840	0.812713	3.692181e-51	-8.615850e-47
Msa0352120	Msa0524020	0.822035	2.938469e-53	-8.615850e-47
Msa0352120	Msa0524570	0.803274	3.769420e-49	-8.615850e-47
Msa0352120	Msa0526130	0.831853	1.319048e-55	-8.615850e-47
Msa0352120	Msa0527420	0.818247	2.165848e-52	-8.615850e-47
Msa0352120	Msa0528870	0.819089	1.394692e-52	-8.615850e-47
Msa0352120	Msa0538100	0.845169	4.802269e-59	-8.615850e-47
Msa0352120	Msa0538140	0.832447	9.404591e-56	-8.615850e-47
Msa0352120	Msa0545350	0.825744	3.965942e-54	-8.615850e-47
Msa0352120	Msa0546020	0.808048	3.750735e-50	-8.615850e-47
Msa0352120	Msa0548230	0.846201	2.520662e-59	-8.615850e-47
Msa0352120	Msa0550280	0.811764	5.947572e-51	-8.615850e-47
Msa0352120	Msa0550720	0.809509	1.827016e-50	-8.615850e-47
Msa0352120	Msa0550820	0.812238	4.687582e-51	-8.615850e-47
Msa0352120	Msa0550840	0.854766	9.892403e-62	-8.615850e-47
Msa0352120	Msa0553350	0.804189	2.433694e-49	-8.615850e-47
Msa0352120	Msa0555940	0.813174	2.924915e-51	-8.615850e-47
Msa0352120	Msa0557770	0.818564	1.835360e-52	-8.615850e-47
Msa0352120	Msa0558220	0.805872	1.082128e-49	-8.615850e-47
Msa0352120	Msa0562040	0.815527	8.831251e-52	-8.615850e-47
Msa0352120	Msa0562740	0.820590	6.327912e-53	-8.615850e-47
Msa0352120	Msa0565930	0.809169	2.160864e-50	-8.615850e-47
Msa0352120	Msa0570310	0.810317	1.224068e-50	-8.615850e-47
Msa0352120	Msa0571070	0.808026	3.791056e-50	-8.615850e-47
Msa0352120	Msa0574450	0.825294	5.069672e-54	-8.615850e-47
Msa0352120	Msa0577140	0.835281	1.838588e-56	-8.615850e-47
Msa0352120	Msa0577910	0.827530	1.486958e-54	-8.615850e-47
Msa0352120	Msa0578400	0.801074	1.068770e-48	-8.615850e-47
Msa0352120	Msa0583810	0.848529	5.783011e-60	-8.615850e-47
Msa0352120	Msa0585770	0.846881	1.644174e-59	-8.615850e-47
Msa0352120	Msa0585810	0.808084	3.684999e-50	-8.615850e-47
Msa0352120	Msa0587060	0.819613	1.059314e-52	-8.615850e-47
Msa0352120	Msa0600940	0.842271	2.863158e-58	-8.615850e-47
Msa0352120	Msa0606180	0.830498	2.839884e-55	-8.615850e-47
Msa0352120	Msa0607070	0.816231	6.151101e-52	-8.615850e-47
Msa0352120	Msa0612150	0.811517	6.729095e-51	-8.615850e-47
Msa0352120	Msa0619060	0.805505	1.292413e-49	-8.615850e-47
Msa0352120	Msa0619170	0.848612	5.485589e-60	-8.615850e-47
Msa0352120	Msa0619870	0.812540	4.027247e-51	-8.615850e-47
Msa0352120	Msa0620270	0.805401	1.358971e-49	-8.615850e-47
Msa0352120	Msa0621870	0.801396	9.183053e-49	-8.615850e-47
Msa0352120	Msa0622400	0.802205	6.265924e-49	-8.615850e-47
Msa0352120	Msa0623350	0.806054	9.911040e-50	-8.615850e-47
Msa0352120	Msa0624240	0.803170	3.961101e-49	-8.615850e-47
Msa0352120	Msa0625820	0.828487	8.746134e-55	-8.615850e-47
Msa0352120	Msa0625850	0.813477	2.509500e-51	-8.615850e-47
Msa0352120	Msa0626890	0.803462	3.446668e-49	-8.615850e-47
Msa0352120	Msa0641400	0.839210	1.815419e-57	-8.615850e-47
Msa0352120	Msa0643800	0.805434	1.337767e-49	-8.615850e-47
Msa0352120	Msa0646710	0.809445	1.885997e-50	-8.615850e-47
Msa0352120	Msa0647110	0.807829	4.175253e-50	-8.615850e-47
Msa0352120	Msa0647710	0.827502	1.509863e-54	-8.615850e-47
Msa0352120	Msa0649140	0.837351	5.472225e-57	-8.615850e-47
Msa0352120	Msa0652360	0.874030	9.287169e-68	-8.615850e-47
Msa0352120	Msa0653530	0.808696	2.728583e-50	-8.615850e-47
Msa0352120	Msa0653690	0.806203	9.218284e-50	-8.615850e-47
Msa0352120	Msa0659130	0.804473	2.124393e-49	-8.615850e-47
Msa0352120	Msa0660160	0.823908	1.074822e-53	-8.615850e-47
Msa0352120	Msa0660410	0.801077	1.067131e-48	-8.615850e-47
Msa0352120	Msa0661490	0.807597	4.676210e-50	-8.615850e-47
Msa0352120	Msa0663540	0.821842	3.256940e-53	-8.615850e-47
Msa0352120	Msa0663630	0.837792	4.216486e-57	-8.615850e-47
Msa0352120	Msa0663650	0.847271	1.285182e-59	-8.615850e-47
Msa0352120	Msa0665010	0.819109	1.379870e-52	-8.615850e-47
Msa0352120	Msa0667710	0.801297	9.624123e-49	-8.615850e-47
Msa0352120	Msa0677590	0.838318	3.088855e-57	-8.615850e-47
Msa0352120	Msa0679880	0.828583	8.293130e-55	-8.615850e-47
Msa0352120	Msa0680930	0.806313	8.739544e-50	-8.615850e-47
Msa0352120	Msa0683650	0.805512	1.288245e-49	-8.615850e-47
Msa0352120	Msa0687540	0.803946	2.735110e-49	-8.615850e-47
Msa0352120	Msa0687650	0.811900	5.554176e-51	-8.615850e-47
Msa0352120	Msa0687740	0.818381	2.018893e-52	-8.615850e-47
Msa0352120	Msa0689980	0.816564	5.183262e-52	-8.615850e-47
Msa0352120	Msa0690530	0.818039	2.413245e-52	-8.615850e-47
Msa0352120	Msa0695930	0.822216	2.666618e-53	-8.615850e-47
Msa0352120	Msa0703620	0.829533	4.882319e-55	-8.615850e-47
Msa0352120	Msa0703760	0.803139	4.020161e-49	-8.615850e-47
Msa0352120	Msa0704570	0.807125	5.889887e-50	-8.615850e-47
Msa0352120	Msa0704750	0.832951	7.051355e-56	-8.615850e-47
Msa0352120	Msa0705610	0.811524	6.707176e-51	-8.615850e-47
Msa0352120	Msa0706490	0.812921	3.323745e-51	-8.615850e-47
Msa0352120	Msa0708120	0.825984	3.479248e-54	-8.615850e-47
Msa0352120	Msa0708450	0.815880	7.367298e-52	-8.615850e-47
Msa0352120	Msa0711510	0.825652	4.170335e-54	-8.615850e-47
Msa0352120	Msa0712070	0.842278	2.850224e-58	-8.615850e-47
Msa0352120	Msa0712500	0.827369	1.625436e-54	-8.615850e-47
Msa0352120	Msa0716430	0.812188	4.808242e-51	-8.615850e-47
Msa0352120	Msa0716670	0.809047	2.294431e-50	-8.615850e-47
Msa0352120	Msa0720380	0.832893	7.289091e-56	-8.615850e-47
Msa0352120	Msa0720850	0.816378	5.704883e-52	-8.615850e-47
Msa0352120	Msa0726000	0.807736	4.369382e-50	-8.615850e-47
Msa0352120	Msa0732100	0.847701	9.787752e-60	-8.615850e-47
Msa0352120	Msa0733110	0.825314	5.016169e-54	-8.615850e-47
Msa0352120	Msa0734430	0.829400	5.257933e-55	-8.615850e-47
Msa0352120	Msa0736120	0.820097	8.210242e-53	-8.615850e-47
Msa0352120	Msa0738400	-0.810881	9.244204e-51	-8.615850e-47
Msa0352120	Msa0748470	0.820675	6.052888e-53	-8.615850e-47
Msa0352120	Msa0748890	0.814423	1.552519e-51	-8.615850e-47
Msa0352120	Msa0749900	0.810662	1.031044e-50	-8.615850e-47
Msa0352120	Msa0749940	0.857981	1.126347e-62	-8.615850e-47
Msa0352120	Msa0751640	0.822322	2.520049e-53	-8.615850e-47
Msa0352120	Msa0753040	0.805069	1.594811e-49	-8.615850e-47
Msa0352120	Msa0760950	0.823965	1.042216e-53	-8.615850e-47
Msa0352120	Msa0761930	0.804894	1.735238e-49	-8.615850e-47
Msa0352120	Msa0762390	0.803736	3.023414e-49	-8.615850e-47
Msa0352120	Msa0762470	0.803482	3.414292e-49	-8.615850e-47
Msa0352120	Msa0766540	0.810387	1.182447e-50	-8.615850e-47
Msa0352120	Msa0772530	0.829539	4.863493e-55	-8.615850e-47
Msa0352120	Msa0773080	0.823582	1.281581e-53	-8.615850e-47
Msa0352120	Msa0774090	0.838738	2.406390e-57	-8.615850e-47
Msa0352120	Msa0775970	0.804342	2.261849e-49	-8.615850e-47
Msa0352120	Msa0794300	0.819419	1.172925e-52	-8.615850e-47
Msa0352120	Msa0796840	0.802676	5.011007e-49	-8.615850e-47
Msa0352120	Msa0798500	0.857310	1.781197e-62	-8.615850e-47
Msa0352120	Msa0803220	0.828026	1.129766e-54	-8.615850e-47
Msa0352120	Msa0803930	0.826443	2.705012e-54	-8.615850e-47
Msa0352120	Msa0810370	0.831461	1.647479e-55	-8.615850e-47
Msa0352120	Msa0811710	0.847271	1.284835e-59	-8.615850e-47
Msa0352120	Msa0814760	0.840588	7.942558e-58	-8.615850e-47
Msa0352120	Msa0815340	0.853693	2.019229e-61	-8.615850e-47
Msa0352120	Msa0829110	0.824070	9.847876e-54	-8.615850e-47
Msa0352120	Msa0830120	0.808744	2.664476e-50	-8.615850e-47
Msa0352120	Msa0830410	0.830269	3.228866e-55	-8.615850e-47
Msa0352120	Msa0830450	0.807728	4.387457e-50	-8.615850e-47
Msa0352120	Msa0831710	0.818045	2.405526e-52	-8.615850e-47
Msa0352120	Msa0837040	0.825798	3.850281e-54	-8.615850e-47
Msa0352120	Msa0841570	0.821721	3.472260e-53	-8.615850e-47
Msa0352120	Msa0841980	0.812826	3.487123e-51	-8.615850e-47
Msa0352120	Msa0846180	0.810366	1.194609e-50	-8.615850e-47
Msa0352120	Msa0851870	0.849949	2.328801e-60	-8.615850e-47
Msa0352120	Msa0853920	0.808060	3.728181e-50	-8.615850e-47
Msa0352120	Msa0855560	0.848978	4.340996e-60	-8.615850e-47
Msa0352120	Msa0866650	0.815856	7.459247e-52	-8.615850e-47
Msa0352120	Msa0879820	0.817597	3.036882e-52	-8.615850e-47
Msa0352120	Msa0880200	0.821957	3.063291e-53	-8.615850e-47
Msa0352120	Msa0880230	0.805419	1.347376e-49	-8.615850e-47
Msa0352120	Msa0881050	0.827263	1.722954e-54	-8.615850e-47
Msa0352120	Msa0893390	0.814327	1.629957e-51	-8.615850e-47
Msa0352120	Msa0894530	0.809563	1.778495e-50	-8.615850e-47
Msa0352120	Msa0905200	0.821451	4.010357e-53	-8.615850e-47
Msa0352120	Msa0910650	0.838979	2.083794e-57	-8.615850e-47
Msa0352120	Msa0921200	0.825612	4.263987e-54	-8.615850e-47
Msa0352120	Msa0929440	0.829266	5.668663e-55	-8.615850e-47
Msa0352120	Msa0937190	0.811442	6.985278e-51	-8.615850e-47
Msa0352120	Msa0937350	0.806771	6.996740e-50	-8.615850e-47
Msa0352120	Msa0941140	0.804849	1.773450e-49	-8.615850e-47
Msa0352120	Msa0946650	0.832304	1.020122e-55	-8.615850e-47
Msa0352120	Msa0959710	0.807523	4.848680e-50	-8.615850e-47
Msa0352120	Msa0959970	0.842017	3.341926e-58	-8.615850e-47
Msa0352120	Msa0967940	0.833271	5.870691e-56	-8.615850e-47
Msa0352120	Msa0968010	0.850849	1.301211e-60	-8.615850e-47
Msa0352120	Msa0970120	0.806482	8.051087e-50	-8.615850e-47
Msa0352120	Msa0974570	0.809373	1.954380e-50	-8.615850e-47
Msa0352120	Msa0985570	0.836185	1.085215e-56	-8.615850e-47
Msa0352120	Msa1011060	0.804598	2.000242e-49	-8.615850e-47
Msa0352120	Msa1011240	0.812031	5.201131e-51	-8.615850e-47
Msa0352120	Msa1014530	0.808833	2.549584e-50	-8.615850e-47
Msa0352120	Msa1018730	0.872318	3.487940e-67	-8.615850e-47
Msa0352120	Msa1022310	0.824168	9.340797e-54	-8.615850e-47
Msa0352120	Msa1022590	0.829202	5.874556e-55	-8.615850e-47
Msa0352120	Msa1024120	0.850129	2.072560e-60	-8.615850e-47
Msa0352120	Msa1033250	0.800409	1.460696e-48	-8.615850e-47
Msa0352120	Msa1035090	0.866504	2.716464e-65	-8.615850e-47
Msa0352120	Msa1038420	0.824480	7.890668e-54	-8.615850e-47
Msa0352120	Msa1040010	0.812578	3.951440e-51	-8.615850e-47
Msa0352120	Msa1040770	0.833670	4.668584e-56	-8.615850e-47
Msa0352120	Msa1052600	0.802150	6.430496e-49	-8.615850e-47
Msa0352120	Msa1055490	0.813797	2.133700e-51	-8.615850e-47
Msa0352120	Msa1056520	0.824413	8.181749e-54	-8.615850e-47
Msa0352120	Msa1061180	0.822367	2.460293e-53	-8.615850e-47
Msa0352120	Msa1061310	0.802260	6.105396e-49	-8.615850e-47
Msa0352120	Msa1061420	0.824637	7.245621e-54	-8.615850e-47
Msa0352120	Msa1066930	0.805260	1.454618e-49	-8.615850e-47
Msa0352120	Msa1067430	0.810691	1.016282e-50	-8.615850e-47
Msa0352120	Msa1075120	0.809562	1.779508e-50	-8.615850e-47
Msa0352120	Msa1082760	0.849670	2.785168e-60	-8.615850e-47
Msa0352120	Msa1084150	0.830281	3.207873e-55	-8.615850e-47
Msa0352120	Msa1090230	0.827253	1.733077e-54	-8.615850e-47
Msa0352120	Msa1103620	0.873607	1.290233e-67	-8.615850e-47
Msa0352120	Msa1106560	0.808222	3.443072e-50	-8.615850e-47
Msa0352120	Msa1106580	0.822428	2.381759e-53	-8.615850e-47
Msa0352120	Msa1106760	0.853578	2.177882e-61	-8.615850e-47
Msa0352120	Msa1107950	0.843814	1.111520e-58	-8.615850e-47
Msa0352120	Msa1116010	0.807047	6.117246e-50	-8.615850e-47
Msa0352120	Msa1121630	0.831832	1.334601e-55	-8.615850e-47
Msa0352120	Msa1127510	0.819895	9.131536e-53	-8.615850e-47
Msa0352120	Msa1127530	0.824549	7.601869e-54	-8.615850e-47
Msa0352120	Msa1128350	0.838518	2.742897e-57	-8.615850e-47
Msa0352120	Msa1129320	0.807289	5.435141e-50	-8.615850e-47
Msa0352120	Msa1129920	0.819924	8.993683e-53	-8.615850e-47
Msa0352120	Msa1140940	0.809747	1.623981e-50	-8.615850e-47
Msa0352120	Msa1144470	0.822576	2.199902e-53	-8.615850e-47
Msa0352120	Msa1147200	0.848998	4.287638e-60	-8.615850e-47
Msa0352120	Msa1149760	0.820179	7.864627e-53	-8.615850e-47
Msa0352120	Msa1149960	0.823511	1.331630e-53	-8.615850e-47
Msa0352120	Msa1150170	0.874379	7.074554e-68	-8.615850e-47
Msa0352120	Msa1156210	0.831452	1.656301e-55	-8.615850e-47
Msa0352120	Msa1162470	0.826780	2.248485e-54	-8.615850e-47
Msa0352120	Msa1165330	0.813505	2.474221e-51	-8.615850e-47
Msa0352120	Msa1173020	0.807651	4.554011e-50	-8.615850e-47
Msa0352120	Msa1175740	0.813827	2.101240e-51	-8.615850e-47
Msa0352120	Msa1177300	0.836724	7.911435e-57	-8.615850e-47
Msa0352120	Msa1179130	0.819068	1.410244e-52	-8.615850e-47
Msa0352120	Msa1179610	0.805558	1.259540e-49	-8.615850e-47
Msa0352120	Msa1180410	0.846362	2.278745e-59	-8.615850e-47
Msa0352120	Msa1182960	0.800612	1.328036e-48	-8.615850e-47
Msa0352120	Msa1183850	0.835084	2.060930e-56	-8.615850e-47
Msa0352120	Msa1185030	0.813810	2.120284e-51	-8.615850e-47
Msa0352120	Msa1186210	0.808811	2.578062e-50	-8.615850e-47
Msa0352120	Msa1188210	0.815204	1.042231e-51	-8.615850e-47
Msa0352120	Msa1189630	0.815418	9.341838e-52	-8.615850e-47
Msa0352120	Msa1193680	0.829501	4.968985e-55	-8.615850e-47
Msa0352120	Msa1196990	0.840901	6.574677e-58	-8.615850e-47
Msa0352120	Msa1198870	0.810003	1.430217e-50	-8.615850e-47
Msa0352120	Msa1200920	0.801607	8.315024e-49	-8.615850e-47
Msa0352120	Msa1206440	0.845047	5.181505e-59	-8.615850e-47
Msa0352120	Msa1207280	0.817048	4.036033e-52	-8.615850e-47
Msa0352120	Msa1208510	0.827609	1.423453e-54	-8.615850e-47
Msa0352120	Msa1208750	0.803682	3.102325e-49	-8.615850e-47
Msa0352120	Msa1212070	0.804673	1.929268e-49	-8.615850e-47
Msa0352120	Msa1213550	0.837205	5.961533e-57	-8.615850e-47
Msa0352120	Msa1214080	0.818806	1.617286e-52	-8.615850e-47
Msa0352120	Msa1216820	0.824433	8.092927e-54	-8.615850e-47
Msa0352120	Msa1217020	0.835030	2.126757e-56	-8.615850e-47
Msa0352120	Msa1217170	0.838462	2.834495e-57	-8.615850e-47
Msa0352120	Msa1222390	0.808973	2.380034e-50	-8.615850e-47
Msa0352120	Msa1223050	0.812579	3.948286e-51	-8.615850e-47
Msa0352120	Msa1223520	0.825181	5.391174e-54	-8.615850e-47
Msa0352120	Msa1224150	0.818805	1.618452e-52	-8.615850e-47
Msa0352120	Msa1226360	0.808819	2.568097e-50	-8.615850e-47
Msa0352120	Msa1229050	0.813652	2.296429e-51	-8.615850e-47
Msa0352120	Msa1232010	0.843708	1.187033e-58	-8.615850e-47
Msa0352120	Msa1232860	0.809290	2.035350e-50	-8.615850e-47
Msa0352120	Msa1234960	0.811991	5.307392e-51	-8.615850e-47
Msa0352120	Msa1235880	0.849442	3.225925e-60	-8.615850e-47
Msa0352120	Msa1235960	0.806627	7.504816e-50	-8.615850e-47
Msa0352120	Msa1235990	0.801503	8.730754e-49	-8.615850e-47
Msa0352120	Msa1236090	0.821451	4.010339e-53	-8.615850e-47
Msa0352120	Msa1239000	0.823840	1.115397e-53	-8.615850e-47
Msa0352120	Msa1244260	0.834189	3.461028e-56	-8.615850e-47
Msa0352120	Msa1249740	0.806925	6.489869e-50	-8.615850e-47
Msa0352120	Msa1250490	0.801702	7.947762e-49	-8.615850e-47
Msa0352120	Msa1250500	0.802237	6.170174e-49	-8.615850e-47
Msa0352120	Msa1254210	0.851733	7.320845e-61	-8.615850e-47
Msa0352120	Msa1257520	0.809529	1.809287e-50	-8.615850e-47
Msa0352120	Msa1258810	0.802088	6.623764e-49	-8.615850e-47
Msa0352120	Msa1261340	0.811273	7.603829e-51	-8.615850e-47
Msa0352120	Msa1261370	0.810128	1.344839e-50	-8.615850e-47
Msa0352120	Msa1262630	0.853644	2.085360e-61	-8.615850e-47
Msa0352120	Msa1263460	0.821199	4.584550e-53	-8.615850e-47
Msa0352120	Msa1263600	0.836005	1.205523e-56	-8.615850e-47
Msa0352120	Msa1264230	0.823355	1.448395e-53	-8.615850e-47
Msa0352120	Msa1269550	0.804571	2.026187e-49	-8.615850e-47
Msa0352120	Msa1271490	0.815455	9.166512e-52	-8.615850e-47
Msa0352120	Msa1274740	0.844769	6.158110e-59	-8.615850e-47
Msa0352120	Msa1275290	0.808836	2.545852e-50	-8.615850e-47
Msa0352120	Msa1275920	0.812544	4.018434e-51	-8.615850e-47
Msa0352120	Msa1279700	0.833172	6.211428e-56	-8.615850e-47
Msa0352120	Msa1284030	0.800777	1.228912e-48	-8.615850e-47
Msa0352120	Msa1291140	0.823105	1.656340e-53	-8.615850e-47
Msa0352120	Msa1293060	0.809823	1.563743e-50	-8.615850e-47
Msa0352120	Msa1293530	0.807835	4.163510e-50	-8.615850e-47
Msa0352120	Msa1296930	0.817650	2.954616e-52	-8.615850e-47
Msa0352120	Msa1297500	0.821021	5.038955e-53	-8.615850e-47
Msa0352120	Msa1297560	0.815627	8.390139e-52	-8.615850e-47
Msa0352120	Msa1302750	0.835452	1.664211e-56	-8.615850e-47
Msa0352120	Msa1302920	0.826173	3.136952e-54	-8.615850e-47
Msa0352120	Msa1303040	0.800984	1.115178e-48	-8.615850e-47
Msa0352120	Msa1306540	0.832880	7.341891e-56	-8.615850e-47
Msa0352120	Msa1306590	0.804872	1.753449e-49	-8.615850e-47
Msa0352120	Msa1309100	0.804406	2.193468e-49	-8.615850e-47
Msa0352120	Msa1312730	0.851924	6.464411e-61	-8.615850e-47
Msa0352120	Msa1314090	0.838439	2.873276e-57	-8.615850e-47
Msa0352120	Msa1314180	0.820080	8.283233e-53	-8.615850e-47
Msa0352120	Msa1315990	0.840188	1.010434e-57	-8.615850e-47
Msa0352120	Msa1316090	0.818873	1.561815e-52	-8.615850e-47
Msa0352120	Msa1317090	0.814097	1.832715e-51	-8.615850e-47
Msa0352120	Msa1317340	0.802932	4.437134e-49	-8.615850e-47
Msa0352120	Msa1322660	0.829233	5.772837e-55	-8.615850e-47
Msa0352120	Msa1325270	0.808772	2.627787e-50	-8.615850e-47
Msa0352120	Msa1330240	0.823634	1.246012e-53	-8.615850e-47
Msa0352120	Msa1331400	0.835357	1.759481e-56	-8.615850e-47
Msa0352120	Msa1331490	0.836313	1.006820e-56	-8.615850e-47
Msa0352120	Msa1331900	0.816556	5.204782e-52	-8.615850e-47
Msa0352120	Msa1334690	0.801754	7.756180e-49	-8.615850e-47
Msa0352120	Msa1336320	0.825591	4.311399e-54	-8.615850e-47
Msa0352120	Msa1341790	0.820048	8.427714e-53	-8.615850e-47
Msa0352120	Msa1346890	0.884727	1.497759e-71	-8.615850e-47
Msa0352120	Msa1348630	0.800274	1.556186e-48	-8.615850e-47
Msa0352120	Msa1348770	0.821039	4.990573e-53	-8.615850e-47
Msa0352120	Msa1349720	0.828870	7.070291e-55	-8.615850e-47
Msa0352120	Msa1351370	0.821076	4.894492e-53	-8.615850e-47
Msa0352120	Msa1351560	0.831983	1.224876e-55	-8.615850e-47
Msa0352120	Msa1355860	0.812387	4.350058e-51	-8.615850e-47
Msa0352120	Msa1364420	0.808069	3.711785e-50	-8.615850e-47
Msa0352120	Msa1364650	0.803851	2.861526e-49	-8.615850e-47
Msa0352120	Msa1367810	0.824314	8.629858e-54	-8.615850e-47
Msa0352120	Msa1369860	0.835170	1.960993e-56	-8.615850e-47
Msa0352120	Msa1371690	0.839486	1.539472e-57	-8.615850e-47
Msa0352120	Msa1372470	0.809080	2.257680e-50	-8.615850e-47
Msa0352120	Msa1373340	0.808875	2.497542e-50	-8.615850e-47
Msa0352120	Msa1374610	0.800289	1.545575e-48	-8.615850e-47
Msa0352120	Msa1374850	0.832824	7.583760e-56	-8.615850e-47
Msa0352120	Msa1375330	0.808261	3.377833e-50	-8.615850e-47
Msa0352120	Msa1375400	0.836900	7.135748e-57	-8.615850e-47
Msa0352120	Msa1375630	0.802535	5.358197e-49	-8.615850e-47
Msa0352120	Msa1376230	0.823068	1.689830e-53	-8.615850e-47
Msa0352120	Msa1376530	0.803217	3.872639e-49	-8.615850e-47
Msa0352120	Msa1376560	0.807597	4.677705e-50	-8.615850e-47
Msa0352120	Msa1376590	0.803993	2.673430e-49	-8.615850e-47
Msa0352120	Msa1379070	0.822900	1.849239e-53	-8.615850e-47
Msa0352120	Msa1379090	0.823624	1.252794e-53	-8.615850e-47
Msa0352120	Msa1386820	0.805768	1.138212e-49	-8.615850e-47
Msa0352120	Msa1387650	0.817657	2.943044e-52	-8.615850e-47
Msa0352120	Msa1390330	0.804478	2.118926e-49	-8.615850e-47
Msa0352120	Msa1391600	0.827922	1.196731e-54	-8.615850e-47
Msa0352120	Msa1393200	0.812637	3.834645e-51	-8.615850e-47
Msa0352120	Msa1397550	0.806479	8.061857e-50	-8.615850e-47
Msa0352120	Msa1398840	0.806267	8.936345e-50	-8.615850e-47
Msa0352120	Msa1404370	0.811100	8.286876e-51	-8.615850e-47
Msa0352120	Msa1405990	0.844048	9.623726e-59	-8.615850e-47
Msa0352120	Msa1406550	0.829616	4.659920e-55	-8.615850e-47
Msa0352120	Msa1407610	0.833714	4.551665e-56	-8.615850e-47
Msa0352120	Msa1414280	0.811037	8.555231e-51	-8.615850e-47
Msa0352120	Msa1415250	0.816478	5.416197e-52	-8.615850e-47
Msa0352120	Msa1419930	0.802450	5.577121e-49	-8.615850e-47
Msa0352120	Msa1420590	0.813181	2.914755e-51	-8.615850e-47
Msa0352120	Msa1421810	0.812737	3.647087e-51	-8.615850e-47
Msa0352120	Msa1422490	0.803603	3.221194e-49	-8.615850e-47
Msa0352120	Msa1422900	0.812337	4.459951e-51	-8.615850e-47
Msa0352120	Msa1424240	0.833613	4.821787e-56	-8.615850e-47
Msa0352120	Msa1425530	0.810341	1.209602e-50	-8.615850e-47
Msa0352120	Msa1426880	0.804814	1.802973e-49	-8.615850e-47
Msa0352120	Msa1427020	0.801097	1.057489e-48	-8.615850e-47
Msa0352120	Msa1429390	0.818763	1.654113e-52	-8.615850e-47
Msa0352120	Msa1430940	0.835246	1.876670e-56	-8.615850e-47
Msa0352120	Msa1434850	0.810886	9.221020e-51	-8.615850e-47
Msa0352120	Msa1435990	0.833605	4.846261e-56	-8.615850e-47
Msa0352120	Msa1437650	0.808619	2.833568e-50	-8.615850e-47
Msa0352120	Msa1437690	0.842180	3.026829e-58	-8.615850e-47
Msa0352120	Msa1438380	0.808984	2.367477e-50	-8.615850e-47
Msa0352120	Msa1439800	0.807903	4.027294e-50	-8.615850e-47
Msa0352120	Msa1444070	0.807506	4.889405e-50	-8.615850e-47
Msa0352120	Msa1444750	0.861961	7.098089e-64	-8.615850e-47
Msa0352120	Msa1449320	0.840163	1.026223e-57	-8.615850e-47
Msa0352120	Msa1455000	0.804919	1.714121e-49	-8.615850e-47
Msa0352120	Msa1455120	0.839595	1.442154e-57	-8.615850e-47

PPI

Gene1	Gene2	Type

Query id	Subject id	identity %	alignment length	mismatches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa0352120	MtrunA17_Chr3g0087261	95.303	511	24	0	14	524	1	511	0.0	1008
Msa0352120	MtrunA17_Chr3g0087271	82.617	512	88	1	14	524	1	512	0.0	867
Msa0352120	MtrunA17_Chr6g0482131	56.367	479	203	4	49	522	35	512	0.0	572
Msa0352120	MtrunA17_Chr4g0033311	54.492	512	223	6	20	522	5	515	0.0	564
Msa0352120	MtrunA17_Chr2g0329201	54.672	503	221	5	26	522	6	507	0.0	561
Msa0352120	MtrunA17_Chr4g0033321	53.906	512	228	5	23	527	4	514	0.0	556
Msa0352120	MtrunA17_Chr6g0482081	54.813	509	221	5	20	520	4	511	0.0	556
Msa0352120	MtrunA17_Chr4g0033201	51.267	513	242	5	17	522	1	512	0.0	554
Msa0352120	MtrunA17_Chr4g0033401	53.801	513	228	5	23	527	4	515	0.0	552
Msa0352120	MtrunA17_Chr3g0088441	54.118	510	225	6	21	522	6	514	0.0	549
Msa0352120	MtrunA17_Chr4g0033341	53.981	515	226	7	14	522	34	543	0.0	548
Msa0352120	MtrunA17_Chr2g0329191	54.812	478	213	3	48	522	32	509	0.0	547
Msa0352120	MtrunA17_Chr4g0033271	51.946	514	239	5	14	522	1	511	0.0	544
Msa0352120	MtrunA17_Chr6g0482071	52.941	510	228	6	21	525	14	516	0.0	543
Msa0352120	MtrunA17_Chr4g0033331	54.564	493	218	4	33	520	22	513	0.0	542
Msa0352120	MtrunA17_Chr4g0033191	52.697	482	222	4	46	522	39	519	0.0	541
Msa0352120	MtrunA17_Chr4g0010501	52.941	476	218	2	49	522	23	494	0.0	533
Msa0352120	MtrunA17_Chr2g0329321	50.297	505	219	5	21	522	13	488	1.30e-178	511
Msa0352120	MtrunA17_Chr6g0482941	50.495	505	243	6	22	524	15	514	2.09e-174	501
Msa0352120	MtrunA17_Chr4g0043091	47.809	502	255	4	27	524	7	505	2.41e-174	501
Msa0352120	MtrunA17_Chr6g0482951	50.297	505	244	6	22	524	15	514	1.77e-173	499
Msa0352120	MtrunA17_Chr4g0033261	48.235	510	231	4	21	522	9	493	1.10e-172	496
Msa0352120	MtrunA17_Chr4g0033231	48.133	482	220	3	46	522	37	493	1.13e-166	481
Msa0352120	MtrunA17_Chr5g0430451	48.738	515	227	5	21	522	8	498	1.55e-162	471
Msa0352120	MtrunA17_Chr4g0042171	47.908	478	241	5	49	520	23	498	7.53e-161	467
Msa0352120	MtrunA17_Chr3g0090131	45.380	487	251	6	43	526	14	488	8.90e-156	453
Msa0352120	MtrunA17_Chr4g0074561	46.653	478	244	5	55	524	40	514	2.65e-152	446
Msa0352120	MtrunA17_Chr3g0090111	44.235	477	254	4	51	526	20	485	4.13e-152	444
Msa0352120	MtrunA17_Chr7g0242691	45.365	507	253	9	20	522	9	495	2.50e-151	443
Msa0352120	MtrunA17_Chr2g0288071	45.117	512	269	5	20	527	44	547	4.50e-150	441
Msa0352120	MtrunA17_Chr2g0288021	45.833	480	254	4	49	524	34	511	1.24e-148	436
Msa0352120	MtrunA17_Chr2g0317841	44.864	477	254	5	49	520	31	503	1.34e-148	436
Msa0352120	MtrunA17_Chr4g0006111	45.510	490	225	6	48	522	63	525	3.88e-148	435
Msa0352120	MtrunA17_Chr2g0317821	44.421	475	259	4	49	520	31	503	1.15e-147	434
Msa0352120	MtrunA17_Chr4g0006971	44.748	476	247	7	49	520	26	489	2.92e-147	432
Msa0352120	MtrunA17_Chr4g0074551	44.660	515	271	5	16	526	24	528	3.55e-147	434
Msa0352120	MtrunA17_Chr4g0006131	46.094	512	228	10	32	525	23	504	6.67e-147	431
Msa0352120	MtrunA17_Chr7g0242681	45.791	487	241	12	44	524	33	502	2.59e-144	425
Msa0352120	MtrunA17_Chr1g0195611	43.933	478	244	8	50	520	27	487	2.79e-136	404
Msa0352120	MtrunA17_Chr5g0428831	42.376	505	260	9	22	520	9	488	4.75e-135	401
Msa0352120	MtrunA17_Chr2g0301231	48.325	418	177	7	118	522	1	392	2.20e-127	377
Msa0352120	MtrunA17_Chr1g0195641	45.063	395	200	5	49	437	26	409	1.27e-117	353
Msa0352120	MtrunA17_Chr5g0418871	50.595	336	161	3	71	402	4	338	1.84e-117	350
Msa0352120	MtrunA17_Chr3g0087201	49.394	330	162	2	192	520	17	342	3.52e-116	347
Msa0352120	MtrunA17_Chr7g0234091	41.053	475	260	7	51	522	76	533	1.24e-110	339
Msa0352120	MtrunA17_Chr7g0234111	41.263	475	255	7	51	520	76	531	3.01e-109	335
Msa0352120	MtrunA17_Chr7g0234131	40.842	475	258	8	51	520	76	532	1.39e-108	334
Msa0352120	MtrunA17_Chr7g0230651	43.175	359	184	6	106	460	27	369	1.57e-92	287
Msa0352120	MtrunA17_Chr3g0087191	65.068	146	49	1	48	191	20	165	2.08e-62	202
Msa0352120	MtrunA17_Chr7g0227561	39.098	266	130	4	52	316	48	282	2.06e-59	198
Msa0352120	MtrunA17_Chr7g0236731	44.538	238	116	3	140	371	31	258	1.82e-53	182
Msa0352120	MtrunA17_Chr4g0068871	26.969	419	235	10	114	525	183	537	4.04e-30	124
Msa0352120	MtrunA17_Chr5g0418861	53.012	83	38	1	439	520	8	90	7.84e-23	92.8
Msa0352120	MtrunA17_Chr8g0352881	45.631	103	55	1	273	375	57	158	1.54e-22	94.4
Msa0352120	MtrunA17_Chr2g0288031	55.932	59	26	0	201	259	5	63	1.85e-17	76.6

Query id	Subject id	identity %	alignment length	mismatches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa0352120	AT2G44480.3	54.622	476	213	2	48	520	64	539	0.0	557
Msa0352120	AT2G44480.1	54.622	476	213	2	48	520	33	508	0.0	556
Msa0352120	AT2G44450.1	51.760	483	226	3	45	524	26	504	2.13e-179	514
Msa0352120	AT5G44640.1	49.603	504	246	4	25	524	6	505	4.24e-179	513
Msa0352120	AT5G42260.1	50.403	496	238	4	25	516	6	497	1.05e-177	510
Msa0352120	AT3G60130.1	51.546	485	222	7	45	523	25	502	1.65e-171	494
Msa0352120	AT1G26560.1	50.209	478	232	4	48	520	30	506	9.71e-170	490
Msa0352120	AT3G18080.1	49.896	479	230	5	48	522	37	509	5.42e-167	483
Msa0352120	AT5G54570.1	49.582	478	234	4	49	520	29	505	6.79e-167	483
Msa0352120	AT2G25630.1	47.695	499	235	6	30	524	10	486	1.06e-165	479
Msa0352120	AT3G18070.1	48.041	485	240	6	44	524	24	500	2.74e-163	473
Msa0352120	AT3G18070.3	47.835	485	235	6	44	524	24	494	6.30e-163	472
Msa0352120	AT2G44480.2	53.448	406	186	2	118	520	1	406	3.66e-162	467
Msa0352120	AT5G24550.1	47.609	481	243	7	50	522	32	511	4.31e-159	464
Msa0352120	AT1G61820.1	47.280	478	246	4	48	520	28	504	6.28e-156	455
Msa0352120	AT1G47600.2	46.465	495	249	7	34	522	26	510	1.53e-155	454
Msa0352120	AT1G47600.1	46.667	495	249	8	34	522	26	511	9.79e-155	452
Msa0352120	AT3G60140.1	46.778	481	248	6	49	522	25	504	6.56e-154	452
Msa0352120	AT1G51470.1	46.465	495	250	8	34	522	26	511	1.94e-152	446
Msa0352120	AT5G24540.1	47.817	481	242	7	50	522	32	511	3.89e-151	443
Msa0352120	AT2G32860.2	47.257	474	241	7	55	520	99	571	3.10e-149	441
Msa0352120	AT1G02850.2	45.208	480	243	7	50	525	26	489	4.85e-148	434
Msa0352120	AT2G44470.3	44.112	501	271	8	30	522	8	507	6.36e-148	437
Msa0352120	AT3G60120.1	45.979	485	253	8	45	522	9	491	1.00e-147	435
Msa0352120	AT5G25980.2	45.898	512	255	12	25	520	17	522	1.49e-147	434
Msa0352120	AT2G32860.1	46.934	473	243	7	55	520	99	570	2.93e-147	436
Msa0352120	AT1G61810.1	43.676	506	276	5	20	520	6	507	7.46e-146	429
Msa0352120	AT5G54570.3	48.821	424	211	3	49	467	29	451	2.14e-144	423
Msa0352120	AT3G60130.2	51.435	418	190	7	112	523	40	450	4.71e-144	422
Msa0352120	AT5G26000.1	46.109	514	255	12	21	520	6	511	5.02e-144	425
Msa0352120	AT2G44490.1	44.399	491	260	9	40	520	5	492	1.21e-143	425
Msa0352120	AT1G02850.5	43.340	503	242	8	50	525	26	512	3.46e-143	422
Msa0352120	AT5G36890.2	43.975	473	252	5	51	520	17	479	3.46e-142	419
Msa0352120	AT5G36890.1	43.975	473	252	5	51	520	17	479	4.16e-142	419
Msa0352120	AT5G54570.2	49.633	409	199	4	118	520	1	408	5.21e-142	416
Msa0352120	AT1G61810.3	45.238	462	247	4	51	507	34	494	1.48e-141	419
Msa0352120	AT1G02850.4	43.254	504	242	9	50	525	26	513	2.27e-141	418
Msa0352120	AT4G21760.2	41.714	525	285	8	6	524	16	525	3.75e-141	418
Msa0352120	AT1G66280.1	43.836	511	274	9	21	523	8	513	1.64e-139	413
Msa0352120	AT4G27830.1	42.012	507	263	10	22	520	1	484	2.38e-139	412
Msa0352120	AT2G44460.1	44.711	501	264	9	30	520	7	504	5.98e-139	414
Msa0352120	AT2G44480.4	61.538	312	117	2	48	357	64	374	3.19e-138	405
Msa0352120	AT4G27820.1	44.167	480	241	8	49	520	22	482	4.24e-137	406
Msa0352120	AT3G03640.1	43.922	510	271	9	22	522	11	514	5.76e-137	407
Msa0352120	AT3G60130.3	50.239	418	184	8	112	523	40	439	7.39e-137	404
Msa0352120	AT1G66270.1	44.330	485	256	9	48	523	34	513	2.82e-136	405
Msa0352120	AT3G21370.1	42.593	486	265	9	49	523	32	514	4.48e-136	404
Msa0352120	AT1G02850.1	43.333	480	225	8	50	525	26	462	1.74e-135	401
Msa0352120	AT1G75940.1	44.033	486	258	9	50	523	37	520	4.65e-135	402
Msa0352120	AT4G22100.1	43.882	474	248	6	51	520	23	482	6.46e-135	401
Msa0352120	AT1G45191.6	44.239	486	243	9	50	524	29	497	5.71e-134	399
Msa0352120	AT4G21760.1	40.762	525	280	9	6	524	16	515	7.83e-134	399
Msa0352120	AT3G09260.1	42.430	502	278	9	29	523	16	513	9.43e-134	399
Msa0352120	AT1G66270.2	44.124	485	255	10	48	523	34	511	2.94e-133	397
Msa0352120	AT1G45191.1	43.813	493	247	9	50	524	29	509	5.59e-133	397
Msa0352120	AT1G45191.4	43.802	484	237	9	50	524	29	486	6.65e-133	395
Msa0352120	AT1G45191.2	44.215	484	241	9	50	524	29	492	6.76e-133	396
Msa0352120	AT3G62750.2	41.061	509	262	10	18	520	23	499	1.79e-131	392
Msa0352120	AT3G62750.1	41.600	500	253	10	27	520	7	473	2.09e-131	392
Msa0352120	AT1G60090.2	43.933	478	242	8	50	520	24	482	2.15e-131	392
Msa0352120	AT1G60090.1	42.827	481	250	6	50	520	24	489	3.75e-131	391
Msa0352120	AT5G25980.3	45.295	457	230	10	25	467	17	467	1.52e-130	388
Msa0352120	AT5G25980.1	45.295	457	230	10	25	467	17	467	1.52e-130	388
Msa0352120	AT1G52400.3	41.860	516	274	10	21	520	10	515	5.21e-130	389
Msa0352120	AT1G52400.1	41.860	516	274	10	21	520	10	515	5.21e-130	389
Msa0352120	AT5G24540.2	47.642	424	214	6	50	466	32	454	1.70e-128	382
Msa0352120	AT5G28510.1	39.844	512	294	8	24	523	13	522	1.66e-127	383
Msa0352120	AT5G26000.2	45.534	459	230	10	21	467	6	456	3.21e-126	377
Msa0352120	AT2G44450.2	50.420	357	172	2	169	524	1	353	4.62e-124	367
Msa0352120	AT2G44470.1	42.793	444	246	7	30	466	8	450	5.86e-124	371
Msa0352120	AT1G61810.5	44.938	405	217	4	121	520	4	407	1.14e-122	366
Msa0352120	AT1G02850.3	44.363	408	192	5	50	431	26	424	6.18e-122	365
Msa0352120	AT1G61810.4	44.604	417	223	4	20	431	6	419	7.36e-122	364
Msa0352120	AT3G60140.2	46.272	389	202	5	49	431	25	412	5.44e-121	363
Msa0352120	AT3G18070.4	50.291	344	162	4	44	383	24	362	4.27e-120	358
Msa0352120	AT3G62740.1	39.623	477	263	8	49	520	22	478	3.97e-119	360
Msa0352120	AT3G62750.4	40.919	457	233	9	18	469	23	447	4.90e-116	351
Msa0352120	AT4G27830.2	42.195	410	216	7	118	520	1	396	9.25e-115	346
Msa0352120	AT1G61820.3	46.556	363	189	3	162	520	4	365	4.40e-113	340
Msa0352120	AT4G27820.2	43.137	408	210	7	121	520	4	397	7.16e-111	336
Msa0352120	AT4G27820.3	43.137	408	210	7	121	520	4	397	7.16e-111	336
Msa0352120	AT1G52400.2	40.998	461	247	9	21	466	10	460	8.91e-110	335
Msa0352120	AT2G44470.2	47.353	340	173	5	30	364	8	346	1.46e-109	332
Msa0352120	AT1G45191.3	45.902	366	178	4	50	405	29	384	2.08e-108	330
Msa0352120	AT5G48375.1	39.752	483	223	9	34	513	22	439	5.71e-108	329
Msa0352120	AT1G45191.5	46.974	347	172	2	50	389	29	370	2.15e-107	327
Msa0352120	AT3G62740.2	42.377	387	205	6	49	431	22	394	9.19e-107	326
Msa0352120	AT1G60270.1	46.647	343	176	2	50	389	24	362	8.11e-106	322
Msa0352120	AT3G62750.7	43.396	371	185	5	27	392	7	357	2.01e-105	320
Msa0352120	AT3G62750.8	43.396	371	185	5	27	392	7	357	2.01e-105	320
Msa0352120	AT3G62750.6	41.076	409	214	8	118	520	1	388	1.81e-104	319
Msa0352120	AT3G62750.5	41.076	409	214	8	118	520	1	388	1.81e-104	319
Msa0352120	AT2G44480.5	48.837	301	153	1	221	520	2	302	2.36e-104	315
Msa0352120	AT3G62750.3	43.011	372	188	5	18	384	23	375	2.77e-104	320
Msa0352120	AT3G18070.2	47.164	335	168	4	194	524	94	423	3.53e-104	319
Msa0352120	AT3G18070.2	52.174	69	32	1	44	112	24	91	6.57e-14	74.3
Msa0352120	AT3G18070.7	46.835	316	159	4	213	524	1	311	6.41e-97	296
Msa0352120	AT1G61810.2	51.311	267	129	1	51	316	34	300	1.98e-94	290
Msa0352120	AT2G44460.2	45.000	360	190	6	167	520	1	358	3.05e-94	294
Msa0352120	AT1G51490.1	44.509	346	167	9	58	394	28	357	3.24e-88	278
Msa0352120	AT1G60270.2	47.253	273	141	1	120	389	3	275	3.69e-84	263
Msa0352120	AT3G18070.5	48.148	243	120	2	194	432	94	334	1.25e-74	240
Msa0352120	AT3G18070.5	52.174	69	32	1	44	112	24	91	3.37e-14	74.3
Msa0352120	AT3G18070.6	47.768	224	111	2	213	432	1	222	1.89e-67	218
Msa0352120	AT5G16580.1	39.583	288	155	5	194	477	27	299	8.11e-57	192
Msa0352120	AT3G06510.1	26.977	430	235	13	107	525	153	514	2.69e-28	119
Msa0352120	AT3G06510.2	26.067	445	254	15	107	525	153	548	8.02e-25	108

Find 119 sgRNAs with CRISPR-Local

Find 322 sgRNAs with CRISPR-GE

CRISPR-Local

CRISPR-Local
sgRNA_sequence	on_target_score	Position	Region
CCAACAAAGATATCATAATT+TGG	0.153192	3_1:+19889509	None:intergenic
GCCATTAAGCATTACATAAT+TGG	0.185949	3_1:+19887695	None:intergenic
ACCAATTATGTAATGCTTAA+TGG	0.213587	3_1:-19887696	Msa0352120:three_prime_UTR
CCAGTGTACATTACTGAAAA+TGG	0.258317	3_1:-19888784	Msa0352120:intron
CTCAAGGTGGTGAAAGAAAT+TGG	0.260524	3_1:-19891919	Msa0352120:CDS
AGAGAAAATCATGAGGAAAA+AGG	0.269873	3_1:+19893356	None:intergenic
TTGGTTGAGCAGATAAGATT+TGG	0.275910	3_1:-19892105	Msa0352120:intron
TTTGATTCTCTAGCAACTTA+AGG	0.279204	3_1:-19887620	Msa0352120:three_prime_UTR
AGCTCTTGAAGATGAATATA+AGG	0.279995	3_1:-19891145	Msa0352120:CDS
ATGGGAGGGGACCAAGTATA+TGG	0.281964	3_1:-19892443	Msa0352120:CDS
CAATAGTGTTGCTGATAAAA+AGG	0.286184	3_1:-19889987	Msa0352120:CDS
CAACAAAGATATCATAATTT+GGG	0.295754	3_1:+19889510	None:intergenic
TCAGCAACACTATTGGAATA+TGG	0.298995	3_1:+19889995	None:intergenic
AGATGTCACTACTTCATCTT+TGG	0.306241	3_1:-19893516	Msa0352120:CDS
CCAAATTATGATATCTTTGT+TGG	0.310176	3_1:-19889509	Msa0352120:CDS
CCATTGATGGTGTATGAATA+AGG	0.315978	3_1:+19890827	None:intergenic
GGTAGTGGAGATGGTCATTA+TGG	0.318482	3_1:+19888573	None:intergenic
TTCCTATGTATTGAGATAAT+TGG	0.329047	3_1:-19887723	Msa0352120:three_prime_UTR
CCTTTGTAACTCTCTTTCAT+TGG	0.333579	3_1:-19891179	Msa0352120:CDS
GAAGGAGCTTCAGATATAGA+TGG	0.339718	3_1:-19892462	Msa0352120:CDS
GCTTCAAGACATTTGGAGAT+AGG	0.339805	3_1:-19890877	Msa0352120:CDS
TACACCATCAATGGATATAA+TGG	0.360639	3_1:-19890818	Msa0352120:CDS
GTGTCATAGGCTCATCAAAA+AGG	0.361616	3_1:-19890055	Msa0352120:intron
CTTTGTAACTCTCTTTCATT+GGG	0.363734	3_1:-19891178	Msa0352120:CDS
TAGCTCGTAAAGATGGTATT+AGG	0.367113	3_1:-19888604	Msa0352120:CDS
TTGATTCTCTAGCAACTTAA+GGG	0.369888	3_1:-19887619	Msa0352120:three_prime_UTR
ACTCATACTTTATTCCTTCA+AGG	0.387045	3_1:+19888549	None:intergenic
AATTGGTTCTTCTGCTTACC+AGG	0.392026	3_1:-19893329	Msa0352120:intron
AGTATACAAGAGAAAATATC+AGG	0.393019	3_1:-19890675	Msa0352120:intron
GTTATAGAATTTCACTCCTA+AGG	0.398406	3_1:+19891351	None:intergenic
GTCAATATGCTTCATTCAAT+AGG	0.402198	3_1:-19893381	Msa0352120:CDS
TCAGTTCTGTCATTTAATCA+TGG	0.402494	3_1:+19893573	None:intergenic
TGGAGATAGGGTTAAGCATT+GGG	0.413839	3_1:-19890864	Msa0352120:CDS
ATTCACACCAAGAAAATCAT+AGG	0.423764	3_1:+19889435	None:intergenic
GCAGGGTACACAGTACGATT+TGG	0.425268	3_1:-19887917	Msa0352120:CDS
AATATCAATAAATAAATTGT+TGG	0.429504	3_1:-19887653	Msa0352120:three_prime_UTR
CTTCAAGACATTTGGAGATA+GGG	0.430530	3_1:-19890876	Msa0352120:CDS
TGGTTGAGCAGATAAGATTT+GGG	0.433770	3_1:-19892104	Msa0352120:intron
GCCACCATTATATCCATTGA+TGG	0.437848	3_1:+19890814	None:intergenic
TTTCAGGCATTGCTACATAT+AGG	0.439893	3_1:-19888649	Msa0352120:intron
CAAATTATGATATCTTTGTT+GGG	0.440379	3_1:-19889508	Msa0352120:CDS
TTGAAGAATGGTGTATCTAT+TGG	0.446784	3_1:-19889223	Msa0352120:CDS
GCTCTTGAAGATGAATATAA+GGG	0.448342	3_1:-19891144	Msa0352120:CDS
TTTGCTCATCCCATTACATA+TGG	0.451264	3_1:-19889541	Msa0352120:CDS
ACAAGATCATGAATTCCCTT+TGG	0.455790	3_1:+19888838	None:intergenic
GGTGGTGAAAGAAATTGGTT+TGG	0.457204	3_1:-19891914	Msa0352120:CDS
TTATTCCTTCAAGGAGGTAG+TGG	0.457529	3_1:+19888558	None:intergenic
TTTGCAGCCATGGGAGCTAT+AGG	0.460190	3_1:-19893484	Msa0352120:CDS
CCTTATTCATACACCATCAA+TGG	0.460986	3_1:-19890827	Msa0352120:CDS
GACAGCTATGAATGGGATGC+AGG	0.461053	3_1:-19887935	Msa0352120:CDS
TTGGAGATAGGGTTAAGCAT+TGG	0.464172	3_1:-19890865	Msa0352120:CDS
ACGATTTGGAATAATTTATG+TGG	0.469400	3_1:-19887903	Msa0352120:CDS
CAGTTCTGTCATTTAATCAT+GGG	0.469451	3_1:+19893574	None:intergenic
GTCAATGTAGCTCGTAAAGA+TGG	0.471396	3_1:-19888611	Msa0352120:CDS
TCTTTACGAGCTACATTGAC+TGG	0.472609	3_1:+19888614	None:intergenic
GTGAATGTGTCCCATATACT+TGG	0.475650	3_1:+19892432	None:intergenic
CATCTCCACTACCTCCTTGA+AGG	0.477901	3_1:-19888563	Msa0352120:CDS
TTCCAGTGACAACAGCCAAA+AGG	0.487795	3_1:+19893428	None:intergenic
GGGATAGTGACCATATGTAA+TGG	0.489610	3_1:+19889531	None:intergenic
GGTAGATGCTCTAAATATGT+TGG	0.494224	3_1:-19890779	Msa0352120:CDS
ATTCATCTTCAAGAGCTTGT+GGG	0.498399	3_1:+19891151	None:intergenic
TTATAGAATTTCACTCCTAA+GGG	0.499133	3_1:+19891352	None:intergenic
TATTCATCTTCAAGAGCTTG+TGG	0.500590	3_1:+19891150	None:intergenic
GCTGCAAAAGTTCCTTCTCA+AGG	0.500855	3_1:-19887834	Msa0352120:CDS
AAGTTATGAGCAACAATGTA+GGG	0.502836	3_1:+19890725	None:intergenic
TGGGAGGGGACCAAGTATAT+GGG	0.502889	3_1:-19892442	Msa0352120:CDS
TCCAGTGACAACAGCCAAAA+GGG	0.503504	3_1:+19893429	None:intergenic
ATTAATGAGATCCTTGCAAA+TGG	0.508823	3_1:-19891322	Msa0352120:intron
TATGTTGGAAATTGTACTAC+TGG	0.509696	3_1:-19890764	Msa0352120:CDS
TTATGCAGACTGATTTGACT+TGG	0.511582	3_1:-19888873	Msa0352120:intron
CAAGTTATGAGCAACAATGT+AGG	0.512417	3_1:+19890724	None:intergenic
AGTAAATACTAAGGTGACAT+TGG	0.517403	3_1:+19887750	None:intergenic
GATATCACAATTTGCAGCCA+TGG	0.521223	3_1:-19893494	Msa0352120:CDS
AAGGAGCTTCAGATATAGAT+GGG	0.521400	3_1:-19892461	Msa0352120:CDS
TGGTGTATCTATTGGTCCCT+CGG	0.524206	3_1:-19889215	Msa0352120:intron
TGGTCAAATAAGTGATATCA+AGG	0.528091	3_1:-19887589	Msa0352120:three_prime_UTR
GGATAGTGACCATATGTAAT+GGG	0.531216	3_1:+19889532	None:intergenic
AGCTTCAGATATAGATGGGA+GGG	0.538873	3_1:-19892457	Msa0352120:CDS
TTCAAAGAAGTGAGTCACTA+AGG	0.542315	3_1:+19890018	None:intergenic
TGGCTCTATGTCTATCCAAA+GGG	0.545375	3_1:-19888853	Msa0352120:CDS
ATGTGAAGGGCTACTATGCT+TGG	0.546370	3_1:-19887967	Msa0352120:CDS
ATATCACAATTTGCAGCCAT+GGG	0.552542	3_1:-19893493	Msa0352120:CDS
CTTCAAGGAGGTAGTGGAGA+TGG	0.557183	3_1:+19888564	None:intergenic
TTGAATGAAGCATATTGACT+TGG	0.557314	3_1:+19893385	None:intergenic
ACATATTTAGAGCATCTACC+AGG	0.559499	3_1:+19890782	None:intergenic
TTGATCACAGCATTGAAGAA+TGG	0.563467	3_1:-19889235	Msa0352120:intron
CTGCAAAAGTTCCTTCTCAA+GGG	0.565586	3_1:-19887833	Msa0352120:CDS
GATATCATATGCAGAGGGCA+AGG	0.565708	3_1:-19891386	Msa0352120:intron
GAATATTCTTGACCATGAGA+TGG	0.567125	3_1:+19891876	None:intergenic
GGAAGGACCTATAGCTCCCA+TGG	0.567501	3_1:+19893477	None:intergenic
CTCCTACATTACCACTGCTA+TGG	0.568763	3_1:+19892080	None:intergenic
ATATCATATGCAGAGGGCAA+GGG	0.568782	3_1:-19891385	Msa0352120:intron
TTGGCTCTATGTCTATCCAA+AGG	0.570642	3_1:-19888854	Msa0352120:CDS
CCAATGAAAGAGAGTTACAA+AGG	0.573192	3_1:+19891179	None:intergenic
TGCATCCCATTCATAGCTGT+CGG	0.573399	3_1:+19887937	None:intergenic
CAATTTCTTTCACCACCTTG+AGG	0.574734	3_1:+19891920	None:intergenic
AGGAACGCAAGTAAATACTA+AGG	0.575832	3_1:+19887741	None:intergenic
ACATTCACTAAACAAAATCC+AGG	0.587307	3_1:-19892417	Msa0352120:intron
TATCATATGCAGAGGGCAAG+GGG	0.588157	3_1:-19891384	Msa0352120:intron
CATACAGATTCTCCATCTCA+TGG	0.592212	3_1:-19891888	Msa0352120:CDS
GCTTCAGATATAGATGGGAG+GGG	0.594992	3_1:-19892456	Msa0352120:CDS
GACCATAGCAGTGGTAATGT+AGG	0.599218	3_1:-19892082	Msa0352120:CDS
CAATGAAAGAGAGTTACAAA+GGG	0.601814	3_1:+19891180	None:intergenic
CTTGAAGCAAAAGTCAGCAT+AGG	0.616391	3_1:+19890892	None:intergenic
TGATTCTCTAGCAACTTAAG+GGG	0.617118	3_1:-19887618	Msa0352120:three_prime_UTR
CAGAGATGGTGCAAATGTGA+AGG	0.618511	3_1:-19887981	Msa0352120:CDS
GATTCTCTAGCAACTTAAGG+GGG	0.619826	3_1:-19887617	Msa0352120:three_prime_UTR
AACAAAGATATCATAATTTG+GGG	0.628062	3_1:+19889511	None:intergenic
CACCAATTATCTCAATACAT+AGG	0.630847	3_1:+19887721	None:intergenic
ACAGCTATGAATGGGATGCA+GGG	0.632968	3_1:-19887934	Msa0352120:CDS
ACCATCAATGGATATAATGG+TGG	0.645165	3_1:-19890815	Msa0352120:CDS
GAGCTTCAGATATAGATGGG+AGG	0.659453	3_1:-19892458	Msa0352120:CDS
ACTGCTTTGTGCATAATATG+TGG	0.670752	3_1:+19889405	None:intergenic
CATACTTTATTCCTTCAAGG+AGG	0.672177	3_1:+19888552	None:intergenic
ATTCCAAAGAGAAAATCATG+AGG	0.675686	3_1:+19893349	None:intergenic
AAGATTTGGGACCATAGCAG+TGG	0.678867	3_1:-19892091	Msa0352120:CDS
AGAGATGGTGCAAATGTGAA+GGG	0.682450	3_1:-19887980	Msa0352120:CDS
ATCATATGCAGAGGGCAAGG+GGG	0.702617	3_1:-19891383	Msa0352120:intron
TTTGTAGGAAGACCTCAAGG+TGG	0.734404	3_1:-19891932	Msa0352120:intron

CRISPR-GE

badsite warning	sgRNA_sequence	Strand	Position	Region	GC_content
!!	ATTAAAATCTAAAAATAAGT+TGG	-	chr3_1:19888462-19888481	Msa0352120:intron	10.0%
!!	AAATCAATGAAAAATAAATA+GGG	+	chr3_1:19888764-19888783	None:intergenic	10.0%
!!!	AAAAATTGTTTTATTTGTAA+AGG	+	chr3_1:19890081-19890100	None:intergenic	10.0%
!!	AATATCAATAAATAAATTGT+TGG	-	chr3_1:19893499-19893518	Msa0352120:CDS	10.0%
!!	TCTATATAAAGCAAAAAAAT+GGG	+	chr3_1:19887619-19887638	None:intergenic	15.0%
!!	ATCTATATAAAGCAAAAAAA+TGG	+	chr3_1:19887620-19887639	None:intergenic	15.0%
!!	AAAATAAATATACTATGTAG+TGG	+	chr3_1:19887855-19887874	None:intergenic	15.0%
!!!	AGTATATTTATTTTGTTACA+TGG	-	chr3_1:19887861-19887880	Msa0352120:CDS	15.0%
!!!	TTTTTTTTTAAGAAGCTAAA+AGG	-	chr3_1:19888268-19888287	Msa0352120:intron	15.0%
!!	CAAATCAATGAAAAATAAAT+AGG	+	chr3_1:19888765-19888784	None:intergenic	15.0%
!!!	CTATTTATTTTTCATTGATT+TGG	-	chr3_1:19888763-19888782	Msa0352120:intron	15.0%
!!	TTTACTTATAAATAGTTTAC+CGG	-	chr3_1:19888799-19888818	Msa0352120:CDS	15.0%
!!!	ATAAACTTCAATTATTTTGT+AGG	-	chr3_1:19889205-19889224	Msa0352120:intron	15.0%
!!	ACAAAAATCAAAATAATAGA+GGG	-	chr3_1:19889621-19889640	Msa0352120:intron	15.0%
!!!	TCATAAAATTTGTTAAAAAG+TGG	-	chr3_1:19889684-19889703	Msa0352120:intron	15.0%
!!	AATGAAATAAAAAAGTTAGT+AGG	-	chr3_1:19890110-19890129	Msa0352120:intron	15.0%
!!!	ATTAATTTAATGGATAAAAC+AGG	-	chr3_1:19890224-19890243	Msa0352120:intron	15.0%
!!	TATTAAATAATTGATGTATC+AGG	-	chr3_1:19890608-19890627	Msa0352120:intron	15.0%
!!!	CAATTTTTGAAATTTATGTT+TGG	-	chr3_1:19891075-19891094	Msa0352120:intron	15.0%
!!!	ACCGAATTTTATTTTTTAAA+TGG	-	chr3_1:19891401-19891420	Msa0352120:intron	15.0%
!!	GCCATTTAAAAAATAAAATT+CGG	+	chr3_1:19891405-19891424	None:intergenic	15.0%
!!!	TATTAATGTTTTTTTTTTCC+AGG	-	chr3_1:19891588-19891607	Msa0352120:intron	15.0%
!!	AGATTACAATATATTTATTG+TGG	+	chr3_1:19892140-19892159	None:intergenic	15.0%
!!!	TTGTTTTATGAATATTTTTC+AGG	-	chr3_1:19892487-19892506	Msa0352120:intron	15.0%
!!	ATATTTAATCAAGAGTTTAA+TGG	-	chr3_1:19892653-19892672	Msa0352120:intron	15.0%
!!	GTTAAACAATAATAATAGTT+AGG	-	chr3_1:19892795-19892814	Msa0352120:intron	15.0%
!!	TTAATACATATTCCAACATA+AGG	-	chr3_1:19887940-19887959	Msa0352120:CDS	20.0%
!!	TAATACATATTCCAACATAA+GGG	-	chr3_1:19887941-19887960	Msa0352120:CDS	20.0%
!!!	AAAAATAGATCTAACGTTTT+TGG	-	chr3_1:19888028-19888047	Msa0352120:intron	20.0%
!!	ACAAATTATTCTTTACAGTA+TGG	-	chr3_1:19888065-19888084	Msa0352120:intron	20.0%
!!	CAAATTATTCTTTACAGTAT+GGG	-	chr3_1:19888066-19888085	Msa0352120:intron	20.0%
!!	TTACTTGAATATTTGTTTCA+AGG	+	chr3_1:19888526-19888545	None:intergenic	20.0%
!!	CATAAACATTTGATATATGT+AGG	+	chr3_1:19888889-19888908	None:intergenic	20.0%
!!!	TATTATGAGGTAATTTTTGT+TGG	-	chr3_1:19888932-19888951	Msa0352120:intron	20.0%
!!	AATTAAATTTCTCTCTATCT+TGG	-	chr3_1:19889028-19889047	Msa0352120:intron	20.0%
!!!	ATATCTTTGTTATCTTACTT+GGG	+	chr3_1:19889301-19889320	None:intergenic	20.0%
!!!	ACAAAGATATCCTTTTTTTT+AGG	-	chr3_1:19889311-19889330	Msa0352120:intron	20.0%
!!!	CAAAGATATCCTTTTTTTTA+GGG	-	chr3_1:19889312-19889331	Msa0352120:intron	20.0%
!!!	AAAGATATCCTTTTTTTTAG+GGG	-	chr3_1:19889313-19889332	Msa0352120:intron	20.0%
!!!	GACAATCATAATTTTACAAA+GGG	-	chr3_1:19889584-19889603	Msa0352120:intron	20.0%
!!!	ATAATTTTACAAAGGGAAAA+AGG	-	chr3_1:19889591-19889610	Msa0352120:intron	20.0%
!!	CACAAAAATCAAAATAATAG+AGG	-	chr3_1:19889620-19889639	Msa0352120:intron	20.0%
!!	ACGATGCATTATAATATAAT+CGG	+	chr3_1:19890153-19890172	None:intergenic	20.0%
!!	TATATATTGCACAAACAAAT+GGG	-	chr3_1:19890532-19890551	Msa0352120:intron	20.0%
!!	TTGTTTATAAATGTGATCAA+AGG	-	chr3_1:19890685-19890704	Msa0352120:CDS	20.0%
!!	TTTCAAATATCATCTTAACT+AGG	+	chr3_1:19890804-19890823	None:intergenic	20.0%
!!	CAATATTAATTATTGGAATG+TGG	+	chr3_1:19890839-19890858	None:intergenic	20.0%
!!	TCGTCAACAATATTAATTAT+TGG	+	chr3_1:19890846-19890865	None:intergenic	20.0%
!!	TTAAGAGAAAAAAGTTTATG+TGG	-	chr3_1:19890915-19890934	Msa0352120:intron	20.0%
!!	TTACCAAATGTAATATTAGT+TGG	+	chr3_1:19890989-19891008	None:intergenic	20.0%
!!!	AATTTTGAGTACTTGTTTAT+AGG	-	chr3_1:19891531-19891550	Msa0352120:intron	20.0%
!!	AACAAAGATATCATAATTTG+GGG	+	chr3_1:19891644-19891663	None:intergenic	20.0%
!!	CAACAAAGATATCATAATTT+GGG	+	chr3_1:19891645-19891664	None:intergenic	20.0%
!!	CAAATTATGATATCTTTGTT+GGG	-	chr3_1:19891644-19891663	Msa0352120:intron	20.0%
!!!	CAATTTAAATTTTCGATCTA+TGG	+	chr3_1:19892053-19892072	None:intergenic	20.0%
!!!	AACAATATCATACAATGTTT+TGG	-	chr3_1:19892217-19892236	Msa0352120:intron	20.0%
!!!	ACAATATCATACAATGTTTT+GGG	-	chr3_1:19892218-19892237	Msa0352120:intron	20.0%
!!	AGCATAATATAATTAGACAA+AGG	+	chr3_1:19892697-19892716	None:intergenic	20.0%
!!	ATTCACAACAAATATTTACT+CGG	-	chr3_1:19892749-19892768	Msa0352120:intron	20.0%
!!	ATTGGAAATTTGAAAAACAA+GGG	+	chr3_1:19893387-19893406	None:intergenic	20.0%
!	CAGAACTGATTAAAAAATCA+TGG	-	chr3_1:19887593-19887612	Msa0352120:three_prime_UTR	25.0%
!	TAGAGAAAAAAGATAGAGAA+GGG	+	chr3_1:19887699-19887718	None:intergenic	25.0%
!	ACAAAATAAGAAGTGAGTAA+TGG	+	chr3_1:19887921-19887940	None:intergenic	25.0%
!!	TTACTATTTGAACTTGTTCA+TGG	-	chr3_1:19887988-19888007	Msa0352120:intron	25.0%
!	TACATTAAAGATTGCAACAT+AGG	+	chr3_1:19888242-19888261	None:intergenic	25.0%
!!!	ATATTTTAAAGCCGTTTTGT+TGG	+	chr3_1:19888403-19888422	None:intergenic	25.0%
!	ATTAGCACAACAAAAAGAAA+TGG	+	chr3_1:19888660-19888679	None:intergenic	25.0%
!!!	TTTTGTTGTGCTAATTTTTC+AGG	-	chr3_1:19888665-19888684	Msa0352120:intron	25.0%
!!	TGATTTTTATCATCGATACA+AGG	-	chr3_1:19889096-19889115	Msa0352120:intron	25.0%
!!	GATATCTTTGTTATCTTACT+TGG	+	chr3_1:19889302-19889321	None:intergenic	25.0%
!!!	AGGACAAATTCATTTTTGTT+GGG	+	chr3_1:19889439-19889458	None:intergenic	25.0%
!!!	AAGGACAAATTCATTTTTGT+TGG	+	chr3_1:19889440-19889459	None:intergenic	25.0%
!	TTAGTGACAAGAGATATTTA+AGG	+	chr3_1:19889459-19889478	None:intergenic	25.0%
!!	GGACAATCATAATTTTACAA+AGG	-	chr3_1:19889583-19889602	Msa0352120:intron	25.0%
!	TTATAGAATTTCACTCCTAA+GGG	+	chr3_1:19889803-19889822	None:intergenic	25.0%
!!!	AACTCATTTTTTTGCTTACA+TGG	-	chr3_1:19889935-19889954	Msa0352120:intron	25.0%
!	GTAAAGGAATTAAGTTACTA+GGG	+	chr3_1:19890065-19890084	None:intergenic	25.0%
!	TGTAAAGGAATTAAGTTACT+AGG	+	chr3_1:19890066-19890085	None:intergenic	25.0%
!	GATGCATTATAATATAATCG+GGG	+	chr3_1:19890151-19890170	None:intergenic	25.0%
!	CGATGCATTATAATATAATC+GGG	+	chr3_1:19890152-19890171	None:intergenic	25.0%
!!!	TATATTAACTTGTTCATGTG+AGG	+	chr3_1:19890194-19890213	None:intergenic	25.0%
!!	ATTTAATGGATAAAACAGGA+AGG	-	chr3_1:19890228-19890247	Msa0352120:intron	25.0%
!	AGTATACAAGAGAAAATATC+AGG	-	chr3_1:19890477-19890496	Msa0352120:intron	25.0%
!	AAGAGAAAATATCAGGTAAT+TGG	-	chr3_1:19890484-19890503	Msa0352120:intron	25.0%
!	CTATATATTGCACAAACAAA+TGG	-	chr3_1:19890531-19890550	Msa0352120:intron	25.0%
!	ATATATTGCACAAACAAATG+GGG	-	chr3_1:19890533-19890552	Msa0352120:intron	25.0%
!	CGATCAATCATTATCAATTA+TGG	-	chr3_1:19890863-19890882	Msa0352120:CDS	25.0%
!	TGACCAACTAATATTACATT+TGG	-	chr3_1:19890983-19891002	Msa0352120:intron	25.0%
!!!	AAATTTATGTTTGGTGTCAT+AGG	-	chr3_1:19891084-19891103	Msa0352120:intron	25.0%
!	CATAAAAAATCTACTTGAGT+TGG	-	chr3_1:19891281-19891300	Msa0352120:intron	25.0%
!	TTTAAAAGTAGAGTAAAGTG+GGG	+	chr3_1:19891327-19891346	None:intergenic	25.0%
!	GTTTAAAAGTAGAGTAAAGT+GGG	+	chr3_1:19891328-19891347	None:intergenic	25.0%
!!!	CACTTTACTCTACTTTTAAA+CGG	-	chr3_1:19891327-19891346	Msa0352120:CDS	25.0%
!!!	ACTTTACTCTACTTTTAAAC+GGG	-	chr3_1:19891328-19891347	Msa0352120:CDS	25.0%
!	CCAACAAAGATATCATAATT+TGG	+	chr3_1:19891646-19891665	None:intergenic	25.0%
!	CCAAATTATGATATCTTTGT+TGG	-	chr3_1:19891643-19891662	Msa0352120:intron	25.0%
!!!	ATTCTAGTTTTGTGAATTTG+GGG	+	chr3_1:19891679-19891698	None:intergenic	25.0%
!!!	GATTCTAGTTTTGTGAATTT+GGG	+	chr3_1:19891680-19891699	None:intergenic	25.0%
!!!	AGATTCTAGTTTTGTGAATT+TGG	+	chr3_1:19891681-19891700	None:intergenic	25.0%
!!	AAAGATTCCTATGATTTTCT+TGG	-	chr3_1:19891710-19891729	Msa0352120:intron	25.0%
!	TGATCAAGTGAAAAATGTAA+TGG	+	chr3_1:19891904-19891923	None:intergenic	25.0%
!	GAAAAAAAAAATCATACCGA+GGG	+	chr3_1:19891956-19891975	None:intergenic	25.0%
!	ATACTACATTTGTGAAGAAT+CGG	+	chr3_1:19892013-19892032	None:intergenic	25.0%
!	TATATTTATTGTGGCTTCAT+AGG	+	chr3_1:19892131-19892150	None:intergenic	25.0%
!!	TTGTATATGCTATAAGTTGA+TGG	+	chr3_1:19892965-19892984	None:intergenic	25.0%
!	AATAAGTTGTTTATCGAAAC+AGG	-	chr3_1:19893084-19893103	Msa0352120:intron	25.0%
!	CATAATGAATTGATTGAACA+TGG	-	chr3_1:19893121-19893140	Msa0352120:intron	25.0%
!!	ACGATTTGGAATAATTTATG+TGG	-	chr3_1:19893249-19893268	Msa0352120:intron	25.0%
!	CATTGGAAATTTGAAAAACA+AGG	+	chr3_1:19893388-19893407	None:intergenic	25.0%
!	TTCCTATGTATTGAGATAAT+TGG	-	chr3_1:19893429-19893448	Msa0352120:CDS	25.0%
!	ACCAATTATGTAATGCTTAA+TGG	-	chr3_1:19893456-19893475	Msa0352120:CDS	25.0%
	CTAGAGAAAAAAGATAGAGA+AGG	+	chr3_1:19887700-19887719	None:intergenic	30.0%
!	TTGAATGAAGCATATTGACT+TGG	+	chr3_1:19887770-19887789	None:intergenic	30.0%
	GTCAATATGCTTCATTCAAT+AGG	-	chr3_1:19887771-19887790	Msa0352120:intron	30.0%
	AGAGAAAATCATGAGGAAAA+AGG	+	chr3_1:19887799-19887818	None:intergenic	30.0%
!	TTTCCTCATGATTTTCTCTT+TGG	-	chr3_1:19887800-19887819	Msa0352120:exon	30.0%
	ATTCCAAAGAGAAAATCATG+AGG	+	chr3_1:19887806-19887825	None:intergenic	30.0%
!!!	CATGATTTTCTCTTTGGAAT+TGG	-	chr3_1:19887806-19887825	Msa0352120:exon	30.0%
	AGCAAACATTGCAAATAAAC+TGG	+	chr3_1:19887967-19887986	None:intergenic	30.0%
	AAAGTAAATACATGTGCATG+TGG	-	chr3_1:19888357-19888376	Msa0352120:intron	30.0%
	TAACAAACAAGCCAACAAAA+CGG	-	chr3_1:19888389-19888408	Msa0352120:intron	30.0%
	GATCTAAACTTCATTCTTAG+TGG	+	chr3_1:19888504-19888523	None:intergenic	30.0%
	ACATTCACTAAACAAAATCC+AGG	-	chr3_1:19888735-19888754	Msa0352120:intron	30.0%
	GAAAAATAAATAGGGTAACC+TGG	+	chr3_1:19888756-19888775	None:intergenic	30.0%
!	TATGCAACTCTTTTCCTATT+TGG	-	chr3_1:19888905-19888924	Msa0352120:intron	30.0%
!	ATGCAACTCTTTTCCTATTT+GGG	-	chr3_1:19888906-19888925	Msa0352120:intron	30.0%
!!!	TATCCTTTTTTTTAGGGGAA+AGG	-	chr3_1:19889318-19889337	Msa0352120:intron	30.0%
	CCAAAAAGTTGTTTACCAAA+TGG	+	chr3_1:19889565-19889584	None:intergenic	30.0%
!	CCATTTGGTAAACAACTTTT+TGG	-	chr3_1:19889562-19889581	Msa0352120:intron	30.0%
	TCTAATGATATCATATGCAG+AGG	-	chr3_1:19889760-19889779	Msa0352120:intron	30.0%
	CTAATGATATCATATGCAGA+GGG	-	chr3_1:19889761-19889780	Msa0352120:intron	30.0%
	GTTATAGAATTTCACTCCTA+AGG	+	chr3_1:19889804-19889823	None:intergenic	30.0%
	ATTAATGAGATCCTTGCAAA+TGG	-	chr3_1:19889830-19889849	Msa0352120:intron	30.0%
!	AGAGATTTTTACCATTTGCA+AGG	+	chr3_1:19889844-19889863	None:intergenic	30.0%
	AGCAAAAAAATGAGTTCTCA+AGG	+	chr3_1:19889931-19889950	None:intergenic	30.0%
!!!	TCATTTTTTTGCTTACATGG+TGG	-	chr3_1:19889938-19889957	Msa0352120:intron	30.0%
	CAATGAAAGAGAGTTACAAA+GGG	+	chr3_1:19889975-19889994	None:intergenic	30.0%
	CTTTGTAACTCTCTTTCATT+GGG	-	chr3_1:19889974-19889993	Msa0352120:CDS	30.0%
	AGCTCTTGAAGATGAATATA+AGG	-	chr3_1:19890007-19890026	Msa0352120:CDS	30.0%
	GCTCTTGAAGATGAATATAA+GGG	-	chr3_1:19890008-19890027	Msa0352120:CDS	30.0%
	TACACCATCAATGGATATAA+TGG	-	chr3_1:19890334-19890353	Msa0352120:intron	30.0%
	TATGTTGGAAATTGTACTAC+TGG	-	chr3_1:19890388-19890407	Msa0352120:intron	30.0%
	AAGTTATGAGCAACAATGTA+GGG	+	chr3_1:19890430-19890449	None:intergenic	30.0%
	TATTCTCACAACTACAAAGT+GGG	+	chr3_1:19890948-19890967	None:intergenic	30.0%
	ATATTCTCACAACTACAAAG+TGG	+	chr3_1:19890949-19890968	None:intergenic	30.0%
	AATATTAGTTGGTCACATGA+AGG	+	chr3_1:19890978-19890997	None:intergenic	30.0%
	GCTCATCAAAAAGGAAAAAT+TGG	-	chr3_1:19891106-19891125	Msa0352120:intron	30.0%
!	CTTTTTATCAGCAACACTAT+TGG	+	chr3_1:19891167-19891186	None:intergenic	30.0%
!	CAATAGTGTTGCTGATAAAA+AGG	-	chr3_1:19891165-19891184	Msa0352120:CDS	30.0%
	CGTTTAAAAGTAGAGTAAAG+TGG	+	chr3_1:19891329-19891348	None:intergenic	30.0%
!!	CTTTACTCTACTTTTAAACG+GGG	-	chr3_1:19891329-19891348	Msa0352120:CDS	30.0%
!!	AATTCTACCGTCCATTTTTA+AGG	+	chr3_1:19891356-19891375	None:intergenic	30.0%
	ATTCACACCAAGAAAATCAT+AGG	+	chr3_1:19891720-19891739	None:intergenic	30.0%
!!!	TAGTCCATTTCGACATTTTT+TGG	+	chr3_1:19891776-19891795	None:intergenic	30.0%
	TTGAAGAATGGTGTATCTAT+TGG	-	chr3_1:19891929-19891948	Msa0352120:intron	30.0%
	GGAAAAAAAAAATCATACCG+AGG	+	chr3_1:19891957-19891976	None:intergenic	30.0%
	GATCTATGGTGTGAAAAAAT+TGG	+	chr3_1:19892039-19892058	None:intergenic	30.0%
	TCTATATCATAACAAATCGC+TGG	-	chr3_1:19892096-19892115	Msa0352120:CDS	30.0%
!!	TTTGGGTTATTTCTTACCTA+AGG	-	chr3_1:19892235-19892254	Msa0352120:intron	30.0%
!	AAGTTTTGCTTGATTACCTT+AGG	+	chr3_1:19892254-19892273	None:intergenic	30.0%
!	GGTAATCAAGCAAAACTTTT+TGG	-	chr3_1:19892256-19892275	Msa0352120:intron	30.0%
!	TTTTATTAGTCAGTAGAAGC+TGG	-	chr3_1:19892437-19892456	Msa0352120:CDS	30.0%
	ACTCATACTTTATTCCTTCA+AGG	+	chr3_1:19892606-19892625	None:intergenic	30.0%
!	GAACATGGTAGTTAATGTTT+TGG	-	chr3_1:19893136-19893155	Msa0352120:intron	30.0%
	AGTAAATACTAAGGTGACAT+TGG	+	chr3_1:19893405-19893424	None:intergenic	30.0%
	CACCAATTATCTCAATACAT+AGG	+	chr3_1:19893434-19893453	None:intergenic	30.0%
	GCCATTAAGCATTACATAAT+TGG	+	chr3_1:19893460-19893479	None:intergenic	30.0%
	TTTGATTCTCTAGCAACTTA+AGG	-	chr3_1:19893532-19893551	Msa0352120:exon	30.0%
	TTGATTCTCTAGCAACTTAA+GGG	-	chr3_1:19893533-19893552	Msa0352120:exon	30.0%
	TGGTCAAATAAGTGATATCA+AGG	-	chr3_1:19893563-19893582	Msa0352120:five_prime_UTR	30.0%
	AGATGTCACTACTTCATCTT+TGG	-	chr3_1:19887636-19887655	Msa0352120:three_prime_UTR	35.0%
	ATATCACAATTTGCAGCCAT+GGG	-	chr3_1:19887659-19887678	Msa0352120:three_prime_UTR	35.0%
	GAAAAAAGATAGAGAAGGGA+AGG	+	chr3_1:19887695-19887714	None:intergenic	35.0%
!	TTTTTCTCTAGCTACCCTTT+TGG	-	chr3_1:19887709-19887728	Msa0352120:three_prime_UTR	35.0%
	TGTTGCTAATGCTAGCTATA+TGG	+	chr3_1:19887891-19887910	None:intergenic	35.0%
	AAATAAACTGGCCCTTATGT+TGG	+	chr3_1:19887955-19887974	None:intergenic	35.0%
	TATTGCCCTTCTTAATGTTG+TGG	-	chr3_1:19888165-19888184	Msa0352120:intron	35.0%
	CATAGCCACAACATTAAGAA+GGG	+	chr3_1:19888173-19888192	None:intergenic	35.0%
	ACATAGCCACAACATTAAGA+AGG	+	chr3_1:19888174-19888193	None:intergenic	35.0%
!	GCAGTAACATCAAGGTATTA+AGG	+	chr3_1:19888220-19888239	None:intergenic	35.0%
	GAGTAACTCATATAAGCTCT+CGG	-	chr3_1:19888424-19888443	Msa0352120:intron	35.0%
	CTAAACTTCATTCTTAGTGG+TGG	+	chr3_1:19888501-19888520	None:intergenic	35.0%
	TTGTATCATGGTCATTTGCA+AGG	+	chr3_1:19888587-19888606	None:intergenic	35.0%
!!!	GTGCTAATTTTTCAGGTAGA+AGG	-	chr3_1:19888672-19888691	Msa0352120:intron	35.0%
	AAGGAGCTTCAGATATAGAT+GGG	-	chr3_1:19888691-19888710	Msa0352120:intron	35.0%
	CCTCATAATACAACCCAAAT+AGG	+	chr3_1:19888922-19888941	None:intergenic	35.0%
!!	CCTATTTGGGTTGTATTATG+AGG	-	chr3_1:19888919-19888938	Msa0352120:intron	35.0%
	TTGGTTGAGCAGATAAGATT+TGG	-	chr3_1:19889047-19889066	Msa0352120:intron	35.0%
	TGGTTGAGCAGATAAGATTT+GGG	-	chr3_1:19889048-19889067	Msa0352120:intron	35.0%
!	TATTTTGTAGGAAGACCTCA+AGG	-	chr3_1:19889217-19889236	Msa0352120:CDS	35.0%
	GAATATTCTTGACCATGAGA+TGG	+	chr3_1:19889279-19889298	None:intergenic	35.0%
	CTTCCTTTCCCCTAAAAAAA+AGG	+	chr3_1:19889324-19889343	None:intergenic	35.0%
!	CTGTTGTTTGAACAACCATT+TGG	-	chr3_1:19889547-19889566	Msa0352120:intron	35.0%
	CCAATGAAAGAGAGTTACAA+AGG	+	chr3_1:19889976-19889995	None:intergenic	35.0%
	CCTTTGTAACTCTCTTTCAT+TGG	-	chr3_1:19889973-19889992	Msa0352120:CDS	35.0%
	ATTCATCTTCAAGAGCTTGT+GGG	+	chr3_1:19890004-19890023	None:intergenic	35.0%
	TATTCATCTTCAAGAGCTTG+TGG	+	chr3_1:19890005-19890024	None:intergenic	35.0%
	AAAAAGTTAGTAGGTGTTCG+AGG	-	chr3_1:19890119-19890138	Msa0352120:intron	35.0%
!	GACTTTTGCTTCAAGACATT+TGG	-	chr3_1:19890268-19890287	Msa0352120:intron	35.0%
	CTTCAAGACATTTGGAGATA+GGG	-	chr3_1:19890276-19890295	Msa0352120:intron	35.0%
!!	CCATTGATGGTGTATGAATA+AGG	+	chr3_1:19890328-19890347	None:intergenic	35.0%
	CCTTATTCATACACCATCAA+TGG	-	chr3_1:19890325-19890344	Msa0352120:intron	35.0%
	ACCATCAATGGATATAATGG+TGG	-	chr3_1:19890337-19890356	Msa0352120:intron	35.0%
!	ACATATTTAGAGCATCTACC+AGG	+	chr3_1:19890373-19890392	None:intergenic	35.0%
!	GGTAGATGCTCTAAATATGT+TGG	-	chr3_1:19890373-19890392	Msa0352120:intron	35.0%
	CAAGTTATGAGCAACAATGT+AGG	+	chr3_1:19890431-19890450	None:intergenic	35.0%
	TTCAAAGAAGTGAGTCACTA+AGG	+	chr3_1:19891137-19891156	None:intergenic	35.0%
	TCAGCAACACTATTGGAATA+TGG	+	chr3_1:19891160-19891179	None:intergenic	35.0%
!!!	CACTTGACTTCTTTTTTGGA+TGG	-	chr3_1:19891200-19891219	Msa0352120:intron	35.0%
	TTAAACGGGGTCCTTAAAAA+TGG	-	chr3_1:19891342-19891361	Msa0352120:CDS	35.0%
!	TCCATGTGTAGTTAGTTTCA+TGG	+	chr3_1:19891499-19891518	None:intergenic	35.0%
	TTTGCTCATCCCATTACATA+TGG	-	chr3_1:19891611-19891630	Msa0352120:intron	35.0%
	GGATAGTGACCATATGTAAT+GGG	+	chr3_1:19891623-19891642	None:intergenic	35.0%
	ACTGCTTTGTGCATAATATG+TGG	+	chr3_1:19891750-19891769	None:intergenic	35.0%
	TGCACCAAAAAATGTCGAAA+TGG	-	chr3_1:19891769-19891788	Msa0352120:intron	35.0%
!	TTGATCACAGCATTGAAGAA+TGG	-	chr3_1:19891917-19891936	Msa0352120:CDS	35.0%
!!	TTATGCAGACTGATTTGACT+TGG	-	chr3_1:19892279-19892298	Msa0352120:intron	35.0%
	ACAAGATCATGAATTCCCTT+TGG	+	chr3_1:19892317-19892336	None:intergenic	35.0%
!	TTTTCAGTAATGTACACTGG+TGG	+	chr3_1:19892368-19892387	None:intergenic	35.0%
!	CCATTTTCAGTAATGTACAC+TGG	+	chr3_1:19892371-19892390	None:intergenic	35.0%
	CCAGTGTACATTACTGAAAA+TGG	-	chr3_1:19892368-19892387	Msa0352120:intron	35.0%
!	TTTCAGGCATTGCTACATAT+AGG	-	chr3_1:19892503-19892522	Msa0352120:intron	35.0%
	TAGCTCGTAAAGATGGTATT+AGG	-	chr3_1:19892548-19892567	Msa0352120:intron	35.0%
	CATACTTTATTCCTTCAAGG+AGG	+	chr3_1:19892603-19892622	None:intergenic	35.0%
!	ATTTTCCGACAGCTATGAAT+GGG	-	chr3_1:19893210-19893229	Msa0352120:intron	35.0%
!!!	TTTTGAGTTTTCCCTTGAGA+AGG	+	chr3_1:19893333-19893352	None:intergenic	35.0%
	AGGAACGCAAGTAAATACTA+AGG	+	chr3_1:19893414-19893433	None:intergenic	35.0%
	TGATTCTCTAGCAACTTAAG+GGG	-	chr3_1:19893534-19893553	Msa0352120:exon	35.0%
	GATATCACAATTTGCAGCCA+TGG	-	chr3_1:19887658-19887677	Msa0352120:three_prime_UTR	40.0%
	TGGAACTGAACCACAAAAAG+TGG	-	chr3_1:19887742-19887761	Msa0352120:three_prime_UTR	40.0%
!!!	TGACTTGGTTCCACTTTTTG+TGG	+	chr3_1:19887755-19887774	None:intergenic	40.0%
!	AATTGGTTCTTCTGCTTACC+AGG	-	chr3_1:19887823-19887842	Msa0352120:CDS	40.0%
	ACTATGTAGTGGTATGAACC+TGG	+	chr3_1:19887844-19887863	None:intergenic	40.0%
	TGCTAATGCTAGCTATATGG+TGG	+	chr3_1:19887888-19887907	None:intergenic	40.0%
!!	GATTTTGATGTCTCTACGAC+AGG	+	chr3_1:19888198-19888217	None:intergenic	40.0%
	CAACATAGGCAGTAACATCA+AGG	+	chr3_1:19888228-19888247	None:intergenic	40.0%
	ATAAGAACCATTCGCGCAAA+AGG	-	chr3_1:19888307-19888326	Msa0352120:intron	40.0%
!	CGCAAAAGGTGTGTTTCAAA+TGG	-	chr3_1:19888321-19888340	Msa0352120:intron	40.0%
	AATGACCATGATACAAGACC+TGG	-	chr3_1:19888591-19888610	Msa0352120:CDS	40.0%
!	AACATCCAGGTCTTGTATCA+TGG	+	chr3_1:19888599-19888618	None:intergenic	40.0%
	AGCAGGATAACATAACATCC+AGG	+	chr3_1:19888612-19888631	None:intergenic	40.0%
	TGGATGTTATGTTATCCTGC+TGG	-	chr3_1:19888611-19888630	Msa0352120:CDS	40.0%
	TTATGTTATCCTGCTGGAGA+AGG	-	chr3_1:19888617-19888636	Msa0352120:CDS	40.0%
	GAAGGAGCTTCAGATATAGA+TGG	-	chr3_1:19888690-19888709	Msa0352120:intron	40.0%
	AGCTTCAGATATAGATGGGA+GGG	-	chr3_1:19888695-19888714	Msa0352120:intron	40.0%
	GTGAATGTGTCCCATATACT+TGG	+	chr3_1:19888723-19888742	None:intergenic	40.0%
	TTACCGGTGAAACTCATACA+CGG	-	chr3_1:19888815-19888834	Msa0352120:CDS	40.0%
	TTACCGTGTATGAGTTTCAC+CGG	+	chr3_1:19888821-19888840	None:intergenic	40.0%
	CAATTTCTTTCACCACCTTG+AGG	+	chr3_1:19889235-19889254	None:intergenic	40.0%
	CTCAAGGTGGTGAAAGAAAT+TGG	-	chr3_1:19889233-19889252	Msa0352120:intron	40.0%
	GGTGGTGAAAGAAATTGGTT+TGG	-	chr3_1:19889238-19889257	Msa0352120:intron	40.0%
	CATACAGATTCTCCATCTCA+TGG	-	chr3_1:19889264-19889283	Msa0352120:intron	40.0%
	ATATCATATGCAGAGGGCAA+GGG	-	chr3_1:19889767-19889786	Msa0352120:intron	40.0%
!!!	TTTTTTGCTTACATGGTGGC+AGG	-	chr3_1:19889942-19889961	Msa0352120:intron	40.0%
	CTTGAAGCAAAAGTCAGCAT+AGG	+	chr3_1:19890263-19890282	None:intergenic	40.0%
	GCTTCAAGACATTTGGAGAT+AGG	-	chr3_1:19890275-19890294	Msa0352120:intron	40.0%
	TTGGAGATAGGGTTAAGCAT+TGG	-	chr3_1:19890287-19890306	Msa0352120:intron	40.0%
	TGGAGATAGGGTTAAGCATT+GGG	-	chr3_1:19890288-19890307	Msa0352120:intron	40.0%
	GCCACCATTATATCCATTGA+TGG	+	chr3_1:19890341-19890360	None:intergenic	40.0%
	CACAACTACAAAGTGGGATT+AGG	+	chr3_1:19890942-19890961	None:intergenic	40.0%
	GTGTCATAGGCTCATCAAAA+AGG	-	chr3_1:19891097-19891116	Msa0352120:intron	40.0%
!!!	CGAGCACTTGACTTCTTTTT+TGG	-	chr3_1:19891196-19891215	Msa0352120:intron	40.0%
	GCCATGAAACTAACTACACA+TGG	-	chr3_1:19891495-19891514	Msa0352120:intron	40.0%
	GGGATAGTGACCATATGTAA+TGG	+	chr3_1:19891624-19891643	None:intergenic	40.0%
	ACACAAACAACGAAATCACG+AGG	+	chr3_1:19891978-19891997	None:intergenic	40.0%
!!	TTGGCTCTATGTCTATCCAA+AGG	-	chr3_1:19892298-19892317	Msa0352120:intron	40.0%
!	TGGCTCTATGTCTATCCAAA+GGG	-	chr3_1:19892299-19892318	Msa0352120:intron	40.0%
	TCTTTACGAGCTACATTGAC+TGG	+	chr3_1:19892541-19892560	None:intergenic	40.0%
	GTCAATGTAGCTCGTAAAGA+TGG	-	chr3_1:19892541-19892560	Msa0352120:intron	40.0%
	TTATTCCTTCAAGGAGGTAG+TGG	+	chr3_1:19892597-19892616	None:intergenic	40.0%
	AGAGATGGTGCAAATGTGAA+GGG	-	chr3_1:19893172-19893191	Msa0352120:intron	40.0%
!	CATTTTCCGACAGCTATGAA+TGG	-	chr3_1:19893209-19893228	Msa0352120:intron	40.0%
!!	ATCCCAAGTACTCTGCTTTT+TGG	-	chr3_1:19893296-19893315	Msa0352120:intron	40.0%
!	AGCCAAAAAGCAGAGTACTT+GGG	+	chr3_1:19893301-19893320	None:intergenic	40.0%
	CTGCAAAAGTTCCTTCTCAA+GGG	-	chr3_1:19893319-19893338	Msa0352120:intron	40.0%
	GATTCTCTAGCAACTTAAGG+GGG	-	chr3_1:19893535-19893554	Msa0352120:exon	40.0%
	TCCAGTGACAACAGCCAAAA+GGG	+	chr3_1:19887726-19887745	None:intergenic	45.0%
	TTCCAGTGACAACAGCCAAA+AGG	+	chr3_1:19887727-19887746	None:intergenic	45.0%
!	AAACACACCTTTTGCGCGAA+TGG	+	chr3_1:19888317-19888336	None:intergenic	45.0%
	GAGCTTCAGATATAGATGGG+AGG	-	chr3_1:19888694-19888713	Msa0352120:intron	45.0%
	GCTTCAGATATAGATGGGAG+GGG	-	chr3_1:19888696-19888715	Msa0352120:intron	45.0%
!	AAGATTTGGGACCATAGCAG+TGG	-	chr3_1:19889061-19889080	Msa0352120:intron	45.0%
!	GACCATAGCAGTGGTAATGT+AGG	-	chr3_1:19889070-19889089	Msa0352120:intron	45.0%
	CTCCTACATTACCACTGCTA+TGG	+	chr3_1:19889075-19889094	None:intergenic	45.0%
	TTTGTAGGAAGACCTCAAGG+TGG	-	chr3_1:19889220-19889239	Msa0352120:CDS	45.0%
	GATATCATATGCAGAGGGCA+AGG	-	chr3_1:19889766-19889785	Msa0352120:intron	45.0%
	TATCATATGCAGAGGGCAAG+GGG	-	chr3_1:19889768-19889787	Msa0352120:intron	45.0%
	CACAAACAAATGGGGTGCAA+TGG	-	chr3_1:19890541-19890560	Msa0352120:intron	45.0%
!	TTATGGTTGATGTGTGCGCA+AGG	-	chr3_1:19890880-19890899	Msa0352120:CDS	45.0%
	GTTGCTGATAAAAAGGCTGC+AGG	-	chr3_1:19891172-19891191	Msa0352120:CDS	45.0%
	ACGGGGTCCTTAAAAATGGA+CGG	-	chr3_1:19891346-19891365	Msa0352120:CDS	45.0%
!	TGTAATGGGATGAGCAAACC+TGG	+	chr3_1:19891609-19891628	None:intergenic	45.0%
	TGGTGTATCTATTGGTCCCT+CGG	-	chr3_1:19891937-19891956	Msa0352120:intron	45.0%
	GCACCATCTCTGCAAGAAAA+GGG	+	chr3_1:19893163-19893182	None:intergenic	45.0%
	TGCACCATCTCTGCAAGAAA+AGG	+	chr3_1:19893164-19893183	None:intergenic	45.0%
	CAGAGATGGTGCAAATGTGA+AGG	-	chr3_1:19893171-19893190	Msa0352120:intron	45.0%
	ATGTGAAGGGCTACTATGCT+TGG	-	chr3_1:19893185-19893204	Msa0352120:intron	45.0%
	TGCATCCCATTCATAGCTGT+CGG	+	chr3_1:19893218-19893237	None:intergenic	45.0%
	ACAGCTATGAATGGGATGCA+GGG	-	chr3_1:19893218-19893237	Msa0352120:intron	45.0%
!	CAGCCAAAAAGCAGAGTACT+TGG	+	chr3_1:19893302-19893321	None:intergenic	45.0%
	GCTGCAAAAGTTCCTTCTCA+AGG	-	chr3_1:19893318-19893337	Msa0352120:intron	45.0%
!!!	AAATTTAATTCTTTTTATTA+AGG	+	chr3_1:19889018-19889037	None:intergenic	5.0%
!!	TAAATAATAAATATATTGAA+AGG	-	chr3_1:19889171-19889190	Msa0352120:intron	5.0%
!!	AATAAATTAATTATTGAAAA+AGG	+	chr3_1:19889890-19889909	None:intergenic	5.0%
!!	TAAACTTATTATTAATTTAA+TGG	-	chr3_1:19890214-19890233	Msa0352120:intron	5.0%
!!	TATACAAAATATTATATTTA+TGG	+	chr3_1:19892179-19892198	None:intergenic	5.0%
	TTTGCAGCCATGGGAGCTAT+AGG	-	chr3_1:19887668-19887687	Msa0352120:three_prime_UTR	50.0%
!!	ACCCTTTTGGCTGTTGTCAC+TGG	-	chr3_1:19887722-19887741	Msa0352120:three_prime_UTR	50.0%
	TCATGCTTACCTTCTCCAGC+AGG	+	chr3_1:19888629-19888648	None:intergenic	50.0%
	ATGGGAGGGGACCAAGTATA+TGG	-	chr3_1:19888709-19888728	Msa0352120:intron	50.0%
	TGGGAGGGGACCAAGTATAT+GGG	-	chr3_1:19888710-19888729	Msa0352120:intron	50.0%
	ATCATATGCAGAGGGCAAGG+GGG	-	chr3_1:19889769-19889788	Msa0352120:intron	50.0%
!	AATGGTGGCACTTTTGCACC+TGG	-	chr3_1:19890352-19890371	Msa0352120:intron	50.0%
!!	CTTCAAGGAGGTAGTGGAGA+TGG	+	chr3_1:19892591-19892610	None:intergenic	50.0%
	CATCTCCACTACCTCCTTGA+AGG	-	chr3_1:19892589-19892608	Msa0352120:intron	50.0%
!	GGTCCCTTTTCTTGCAGAGA+TGG	-	chr3_1:19893157-19893176	Msa0352120:intron	50.0%
	GACAGCTATGAATGGGATGC+AGG	-	chr3_1:19893217-19893236	Msa0352120:intron	50.0%
	GCAGGGTACACAGTACGATT+TGG	-	chr3_1:19893235-19893254	Msa0352120:intron	50.0%
	TCTAGCAACTTAAGGGGGCA+TGG	-	chr3_1:19893540-19893559	Msa0352120:five_prime_UTR	50.0%
	GGAAGGACCTATAGCTCCCA+TGG	+	chr3_1:19887678-19887697	None:intergenic	55.0%
	AAGGGGGCAGTCAATCCCTT+AGG	-	chr3_1:19889785-19889804	Msa0352120:intron	55.0%
!	AGCAACTTAAGGGGGCATGG+TGG	-	chr3_1:19893543-19893562	Msa0352120:five_prime_UTR	55.0%

Chromosome	Type	Strat	End	Strand	Name
chr3_1	gene	19887581	19893593	19887581	ID=Msa0352120;Name=Msa0352120
chr3_1	mRNA	19887581	19893593	19887581	ID=Msa0352120-mRNA-1;Parent=Msa0352120;Name=Msa0352120-mRNA-1;_AED=0.11;_eAED=0.11;_QI=57\|1\|1\|1\|0.92\|0.85\|14\|216\|527
chr3_1	exon	19887581	19887776	19887581	ID=Msa0352120-mRNA-1:exon:4691;Parent=Msa0352120-mRNA-1
chr3_1	exon	19887797	19888000	19887797	ID=Msa0352120-mRNA-1:exon:4690;Parent=Msa0352120-mRNA-1
chr3_1	exon	19888557	19888665	19888557	ID=Msa0352120-mRNA-1:exon:4689;Parent=Msa0352120-mRNA-1
chr3_1	exon	19888785	19888887	19888785	ID=Msa0352120-mRNA-1:exon:4688;Parent=Msa0352120-mRNA-1
chr3_1	exon	19889216	19889247	19889216	ID=Msa0352120-mRNA-1:exon:4687;Parent=Msa0352120-mRNA-1
chr3_1	exon	19889350	19889564	19889350	ID=Msa0352120-mRNA-1:exon:4686;Parent=Msa0352120-mRNA-1
chr3_1	exon	19889953	19890068	19889953	ID=Msa0352120-mRNA-1:exon:4685;Parent=Msa0352120-mRNA-1
chr3_1	exon	19890676	19890928	19890676	ID=Msa0352120-mRNA-1:exon:4684;Parent=Msa0352120-mRNA-1
chr3_1	exon	19891123	19891210	19891123	ID=Msa0352120-mRNA-1:exon:4683;Parent=Msa0352120-mRNA-1
chr3_1	exon	19891323	19891394	19891323	ID=Msa0352120-mRNA-1:exon:4682;Parent=Msa0352120-mRNA-1
chr3_1	exon	19891872	19891947	19891872	ID=Msa0352120-mRNA-1:exon:4681;Parent=Msa0352120-mRNA-1
chr3_1	exon	19892057	19892115	19892057	ID=Msa0352120-mRNA-1:exon:4680;Parent=Msa0352120-mRNA-1
chr3_1	exon	19892418	19892487	19892418	ID=Msa0352120-mRNA-1:exon:4679;Parent=Msa0352120-mRNA-1
chr3_1	exon	19893330	19893593	19893330	ID=Msa0352120-mRNA-1:exon:4678;Parent=Msa0352120-mRNA-1
chr3_1	five_prime_UTR	19893537	19893593	19893537	ID=Msa0352120-mRNA-1:five_prime_utr;Parent=Msa0352120-mRNA-1
chr3_1	CDS	19893330	19893536	19893330	ID=Msa0352120-mRNA-1:cds;Parent=Msa0352120-mRNA-1
chr3_1	CDS	19892418	19892487	19892418	ID=Msa0352120-mRNA-1:cds;Parent=Msa0352120-mRNA-1
chr3_1	CDS	19892057	19892115	19892057	ID=Msa0352120-mRNA-1:cds;Parent=Msa0352120-mRNA-1
chr3_1	CDS	19891872	19891947	19891872	ID=Msa0352120-mRNA-1:cds;Parent=Msa0352120-mRNA-1
chr3_1	CDS	19891323	19891394	19891323	ID=Msa0352120-mRNA-1:cds;Parent=Msa0352120-mRNA-1
chr3_1	CDS	19891123	19891210	19891123	ID=Msa0352120-mRNA-1:cds;Parent=Msa0352120-mRNA-1
chr3_1	CDS	19890676	19890928	19890676	ID=Msa0352120-mRNA-1:cds;Parent=Msa0352120-mRNA-1
chr3_1	CDS	19889953	19890068	19889953	ID=Msa0352120-mRNA-1:cds;Parent=Msa0352120-mRNA-1
chr3_1	CDS	19889350	19889564	19889350	ID=Msa0352120-mRNA-1:cds;Parent=Msa0352120-mRNA-1
chr3_1	CDS	19889216	19889247	19889216	ID=Msa0352120-mRNA-1:cds;Parent=Msa0352120-mRNA-1
chr3_1	CDS	19888785	19888887	19888785	ID=Msa0352120-mRNA-1:cds;Parent=Msa0352120-mRNA-1
chr3_1	CDS	19888557	19888665	19888557	ID=Msa0352120-mRNA-1:cds;Parent=Msa0352120-mRNA-1
chr3_1	CDS	19887817	19888000	19887817	ID=Msa0352120-mRNA-1:cds;Parent=Msa0352120-mRNA-1
chr3_1	three_prime_UTR	19887797	19887816	19887797	ID=Msa0352120-mRNA-1:three_prime_utr;Parent=Msa0352120-mRNA-1
chr3_1	three_prime_UTR	19887581	19887776	19887581	ID=Msa0352120-mRNA-1:three_prime_utr;Parent=Msa0352120-mRNA-1

Gene Sequence

>Msa0352120

ATGTCACTACTTCATCTTTGGATATCACAATTTGCAGCCATGGGAGCTATAGGTCCTTCCCTTCTCTATCTTTTTTCTCTAGCTACCCTTTTGGCTGTTGTCACTGGAACTGAACCACAAAAAGTGGAACCAAGTCAATATGCTTCATTCAATAGGAGCCTTTTTCCTCATGATTTTCTCTTTGGAATTGGTTCTTCTGCTTACCAGGTAGAAGGAGCTTCAGATATAGATGGGAGGGGACCAAGTATATGGGACACATTCACTAAACAAAATCCAGATAAGATTTGGGACCATAGCAGTGGTAATGTAGGAGCTGATTTTTATCATCGATACAAGGAAGACCTCAAGGTGGTGAAAGAAATTGGTTTGGACTCATACAGATTCTCCATCTCATGGTCAAGAATATTCCCAAAGGGCAAGGGGGCAGTCAATCCCTTAGGAGTGAAATTCTATAACAATCTCATTAATGAGATCCTTGCAAATGGCTTAGTACCCTTTGTAACTCTCTTTCATTGGGATCTCCCACAAGCTCTTGAAGATGAATATAAGGGATTTCTAAGTAAAAATATAACGAAGGATTTTGCAGCCTATGCTGACTTTTGCTTCAAGACATTTGGAGATAGGGTTAAGCATTGGGTGACACTTAATGAACCTTATTCATACACCATCAATGGATATAATGGTGGCACTTTTGCACCTGGTAGATGCTCTAAATATGTTGGAAATTGTACTACTGGTGACTCAAGTACAGAGCCCTACATTGTTGCTCATAACTTGATACTTTCTCATGCTGCTGCAGTCAGAGTATACAAGAGAAAATATCAGGCTCATCAAAAAGGAAAAATTGGAGTGACCTTAGTGACTCACTTCTTTGAACCATATTCCAATAGTGTTGCTGATAAAAAGGCTGCAGGTCGAGCACTTGACTTCTTTTTTGGATGGTTTGCTCATCCCATTACATATGGTCACTATCCCCAAATTATGATATCTTTGTTGGGTAAAAGACTCCCCAAATTCACAAAACTAGAATCTGTAATTATCAAAGATTCCTATGATTTTCTTGGTGTGAATTATTACTCCACATATTATGCACAAAGCAGTGCACCAAAAAATGTCGAAATGGACTACTACTCTGATATGCAAGCAACTGTCTCTCCATTGAAGAATGGTGTATCTATTGGTCCCTCGACTGATTTGACTTGGCTCTATGTCTATCCAAAGGGAATTCATGATCTTGTTACACACATAAAAAATGTATACAAGAATCCACCAGTGTACATTACTGAAAATGGCATTGCTACATATAGGAATGACTCAATTCCAGTCAATGTAGCTCGTAAAGATGGTATTAGGATTAAATACCATAATGACCATCTCCACTACCTCCTTGAAGGAATAAAAGATGGTGCAAATGTGAAGGGCTACTATGCTTGGTCATTTTCCGACAGCTATGAATGGGATGCAGGGTACACAGTACGATTTGGAATAATTTATGTGGATTTCGTTAAGAATTTGAAAAGATATCCCAAGTACTCTGCTTTTTGGCTGCAAAAGTTCCTTCTCAAGGGAAAACTCAAAATTTGA

Protein sequence

>Msa0352120

MSLLHLWISQFAAMGAIGPSLLYLFSLATLLAVVTGTEPQKVEPSQYASFNRSLFPHDFLFGIGSSAYQVEGASDIDGRGPSIWDTFTKQNPDKIWDHSSGNVGADFYHRYKEDLKVVKEIGLDSYRFSISWSRIFPKGKGAVNPLGVKFYNNLINEILANGLVPFVTLFHWDLPQALEDEYKGFLSKNITKDFAAYADFCFKTFGDRVKHWVTLNEPYSYTINGYNGGTFAPGRCSKYVGNCTTGDSSTEPYIVAHNLILSHAAAVRVYKRKYQAHQKGKIGVTLVTHFFEPYSNSVADKKAAGRALDFFFGWFAHPITYGHYPQIMISLLGKRLPKFTKLESVIIKDSYDFLGVNYYSTYYAQSSAPKNVEMDYYSDMQATVSPLKNGVSIGPSTDLTWLYVYPKGIHDLVTHIKNVYKNPPVYITENGIATYRNDSIPVNVARKDGIRIKYHNDHLHYLLEGIKDGANVKGYYAWSFSDSYEWDAGYTVRFGIIYVDFVKNLKRYPKYSAFWLQKFLLKGKLKI*